Cost and time schedule 10 Cost and time schedule In this chapter, a summar y of the complete project cost is given, the basic schedule from star t of construction until end of commissioning is discussed and the resulting budget profile over all phases of the project is described. ... 20 XFEL TDR.indb 620 12/10/2007 15:28:06 Cost and time schedule Figure 10.1.1 Breakdown of project construction cost (sum of capital investment and personnel cost) into the work package groups. ... Figure10.5.3 project. ...

Еще в разделе: (Показать все результаты (>121) - nuclphys.sinp.msu.ru/ )

• Альфа-распад (измерения)
• Определение периода полураспада и сечения взаимодействия тепловых нейтронов
• Определение расстояния между источником и детектором

Volume Functions of Historical Texts and the Amplitude Correlation Principle Anatoliy T. Fomenko* *Department of Mathematics and Mechanics, Moscow University, Leninskie Gory Moscow, 119889, U.S.S.R. and Svetlozar ... Santa Barbara, California 93106, U.S.A. Abstract: A new empirico-statistical model is suggested to distinguish dependent narrative texts from independent narrative texts by means of their ... A qualitative definition of rich and poor texts is intuitively clear (Figure 3). ...

Еще в разделе: (Показать все результаты (>94) - hbar.phys.msu.ru/ )

• http://hbar.phys.msu.ru/gorm/ahist/antikythera1.pdf
• http://hbar.phys.msu.ru/hbar/pages/vyat/vyate.html
• http://hbar.phys.msu.ru/gorm/atext/steph4.pdf

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>18) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

Norwegian Libraries: . ... ARLIS - Kunstbib: Norwegian Art History Bibliography. ... The Norwegian Museum of Architecture . ... Art Museums . ... Henie-Onstad Art Center - Hovikodden: Norway's first Museum of Fine Arts on Internet. The Astrup Fearnley Museum of Modern Art . ... National Museum of American Art . Dallas Museum of Art . ... Electra '96 Henie Onstad Art Center's Project for Electronic Media. ... WWW-Library: History of Art . ... News: rec.fine.arts . ... News: k12.ed.art . ...

Еще в разделе: (Показать все результаты (>16) - www.hist.msu.ru/ )

• The Laboratory of Historical Information Sciences

Cell Biology International. ... Drugs, time of treatment Control active centriole inactive centriole DNP , 30min active centriole inactive centriole active centriole inactive centriole active centriole inactive centriole active centriole inactive centriole Short MTs with Long MTs with Short MTs with Long MTs with Total number free ends attached end attached end free ends of ... 50.4 ± 3.1 MTs radiated from the centrosome in cells treated with DNP for 30 min. ...

Еще в разделе: (Показать все результаты (>34) - cellmotility.genebee.msu.ru/ )

• http://cellmotility.genebee.msu.ru/html/articles/uzbekov96.pdf
• http://cellmotility.genebee.msu.ru/html/articles/chern01.pdf
• http://cellmotility.genebee.msu.ru/html/articles/alieva97.pdf

... Reconstruction of the Polarization States of a Biphoton Field Yu. ... 31, Moscow, 115409 Russia Received June 7, 2005 A method for reconstructing an arbitrary quantum state of an optical system in Hilbert space with dimension d = 4 is discussed. ... At present, nearly complete control has apparently been achieved over two-level optical systems-- polarization, spatial, and frequency states of single photons. ... 3 2005 RECONSTRUCTION OF THE POLARIZATION STATES 167 Fig. ...

Еще в разделе: (Показать все результаты (>74) - qi.phys.msu.ru/ )

• http://qi.phys.msu.ru/kulik/Papers/JETP_lett_05.pdf
• http://qi.phys.msu.ru/papers/2013-njp-15-035012.pdf
• PUBLIC

данных о себе // режимы работы // старт - приглашения для регистрации, редактирования // регистрация // редактирование (personal_id= password = все в строке запроса) // загрузка файла loadfoto (она же смена файла) // require _once($ GLOBALS [ DOCUMENT_ROOT ]. / mikromag /script/config.php3 ); require _once($ GLOBALS [ DOCUMENT_ROOT ]. / ...

Еще в разделе: (Показать все результаты (>35) - genphys.phys.msu.su/ )

• http://genphys.phys.msu.su/mikromag/script/registraciya.php3
• http://genphys.phys.msu.su/mikromag/script/show_user_data.php3
• http://genphys.phys.msu.su/mikromag/script/spisok_polz.php3

... Moscow State University, Geological Faculty, Dept. of Geophysics . ... March 2000 In 1999 the TRF_2D automated 2D inversion Program for VES travers data was developed by Near-Surface Electrical Lab. ... Automated 2D Inversion Basics . TRF_2D for Windows Principal Specifications . TRF_2D for Windows Test Example . Using TRF_2D for Windows - Field Example . TRF_2D for Windows Limitations for Usage . ... Dept. of Geophysics, Geological Faculty, MSU . ...

Еще в разделе: (Показать все результаты (>50) - geophys.geol.msu.ru/ )

• Near-surface electrical prospecting laboratory at Moscow University
• Researchs

... Graduated from M.Lomonosov Moscow State University, Department of Mechanics and Mathematics. Dissertation's title of Ph.D. (Phys.& Math): "Aerodynamic Characteristics, Shape-Formation and Stressed-Strained State of Parachute Canopy." ... Graduated from M.Lomonosov Moscow State University, Piano Class. ... Development of mathematical models and parameter computation methods for the shape, aerodynamic drag and stressed-strained state of parachutes with different canopy geometry. ...

Еще в разделе: (Показать все результаты (>6) - margaret.imec.msu.ru/ )

• teachers

. 1 2 3 4 5 . 2002-2016, Кафедра физики моря и вод суши . Поддержка сайта: phys.msu.ru?Subject=ocean.phys.msu.ru" class="copyright">Сергей Колесов .

Еще в разделе: (Показать все результаты (>18) - ocean.phys.msu.ru/ )

• [Новости] КАФЕДРА ФИЗИКИ МОРЯ И ВОД СУШИ
• [Учеба] КАФЕДРА ФИЗИКИ МОРЯ И ВОД СУШИ

... Начало www.99ru.ru Отзывы . ... Искусство . История.Философия . ... Художественные . ... История Всемирная . ... Детские . ... Психология семейной жизни . ... Искусство и культура . Архитектура и зодчество . Другие виды искусства . ... Теория искусств.Эстетика . ... Этнография Фольклор . ... Военное дело Военная история . ... Психология . ... Наследие Востока . Наследие Европы, Руны . ... Германское наследие . ... Здрава, Боевые искусства . ... Фольклор . ... СССР (после 1917) . ...

Еще в разделе: (Показать все результаты (>56) - www.bukivedi.ru/ )

• www.99ru.ru - 1984 6242

EDUCATION: 1997 Ph.D. Thesis: Direct synthesis of new Sillen phases with non-centrosymmetric structure, Moscow, MSU . 1993-1996 Post Graduate study on Inorganic Chemistry Division, Department of Chemistry, MSU . ... Oleg Janson, Alexander A. Tsirlin, Elena S. Osipova, Peter S. Berdonosov, Andrei V. Olenev, Valery A. Dolgikh, and Helge Rosner CaCu 2 (SeO 3 ) 2 Cl 2 : Spin-1/2 Heisenberg chain compound with complex frustrated interchain coupling // Phys. Rev. B 83, (2011)144423 . ...

Еще в разделе: (Показать все результаты (>34) - www.inorg.chem.msu.ru/ )

• The Sheelkov group
• Inorganic Chemistry Division

... Destructive effects of many tsunamis are confined to areas within about one hour of the initial propagation time (that is, within a few hundred km of their source). ... Two international tsunami workshops have recently been held in Russia ( "Tsunami Mitigation and Risk Assessment," Petropavlovsk-Kamchatskiy,1996 , and "Tsunami Risk Assessment Beyond 2000: Theory, Practice and Plans," Moscow, 2000). ... The final product of the workshop will be recommendations on local tsunami warning and mitigation....

Еще в разделе: (Показать все результаты (>24) - seac47-2.phys.msu.ru/ )

Schools of Philology, Psychology, and of the Arts, Moscow State University held 1-3 October, 2010 an international conference entitled . FREE VERSE AND FREE DANCE: EMBODIED SENSE IN MOTION . ... In addition to paper sessions and thematic round-table discussions, the conference included master classes in free dance & musical movement training, sessions of vers libres, sound poetry, dance and contact improvisation, and site-specific performances. All master classes were open for participants. ...

Еще в разделе: (Показать все результаты (>6) - discours.philol.msu.ru/ )

Franco Peracchi IV and GMM under weak instruments Spring 2011 Course outline 1. The instrumental variables (IV) method · · · · · · · · · · · · · · · · · · · · · · · · · · · · Inconsistency of OLS The simple IV estimator The class of IV estimators Sampling properties Estimates of statistical precision Hypothesis testing 2SLS Motivating examples Definitions and basic models The bias of 2SLS Standard asymptotic approximations Alternative asymptotic approximations Detecting weak ...

Еще в разделе: (Показать все результаты (>19) - www.mse-msu.ru/ )

• http://www.mse-msu.ru/files/endis.doc
• http://www.mse-msu.ru/Nekipeliv_31012011.pdf

... TEX METAFONT , TEX - . ... TEX; Internet ftp://sunsite.unc.edu/pub/academic/russianstudies/Software/PSfonts/pscyr.tar.gz. ... AcademyPSCyr), Regular , Bold , Italic · (HandbookPSCyr), Regular , Bold , Italic · (CollegePSCyr), Regular , Bold , Italic · (AntiquaPSCyr), Regular , Bold , Italic · (Lazurski), Regular · (TimesNewRomanPSMT), Regular , Bold , Italic , Bold Italic : · (ArialMT), Regular , Bold , Italic , Bold Italic , Black · (TextbookPSCyr), Regular , Bold ,...

Еще в разделе: (Показать все результаты (>4) - scon155.phys.msu.ru/ )

... Trimodal nanoporosity of porous glasses . ... Polymodal nanoporosity of porous glasses with normal type of light scattering was studied by two new methods: a kinetic method of diffusion diagnostics (DD-method) and an equilibrium method of gas desorption at low partial pressures (LPED-method). The computer fitting of diffusion and equilibrium desorption isotherms of nitrogen, oxygen and argon at 77.5 K revealed the availability microporous substructure in mesoporous materials. ...

Еще в разделе: (Показать все результаты (>39) - www.kge.msu.ru/ )

• Глумление над реестром. Файлы, папки и т.п.
• Глумление над реестром. Связь.
• Публикации

... Master's Programme . ... On-line консультант . ... Master s Programme Enterprise Resource Management System has been developed basing on methodology from SAP, Oracle, Microsoft Companies, as well as the experience of national higher school and international universities. The key objective (mission) of the Programme is to educate professionals in the organization and implementation of projects aimed at deployment and maintenance of ERP systems at domestic enterprises. ...

Еще в разделе: (Показать все результаты (>11) - erp.cmc.msu.ru/ )

О лаборатории . ... Лаборатория теоретической биофизики . ... In our previous article (<a href=? http://erg.biophys.msu.ru/wordpress/archives/706 ? ... Here we generalize this technique for the љtwo-dimensional space. ... Let us demonstrate how the discrete Laplacian is used in explicit scheme of solving the reaction-diffusion system . ... Нет комментариев " Reaction-diffusion systems in 2D space with python " . ... Reaction-diffusion systems in 2D space with python . ... 2016 ERG Research Group . ...

Еще в разделе: (Показать все результаты (>25) - erg.biophys.msu.ru/ )

... О факультете . ... Master In Ecology . Master In Nanobiotechnology . ... Nanobiotechnology and Biophysics? is intended for prospective highly qualified professionals with in-depth knowledge in of modern biophysics, molecular biology and nanobiotechnology. ... The program is focused at problems of modern nanobiotechnology, biophysics and proteomics, and hence it consists of the two parts: lectures/seminars and laboratory work. ... Lectures / Practical . ... Биологический факультет МГУ . ...

Еще в разделе: (Показать все результаты (>6) - www.bio.msu.ru/ )

• Master In Ecology ? Биологический факультет МГУ
• The Second White Sea Molecular Zoology Summer School ? Биологический факультет