... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>14) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• ConClus

... Ключевые слова: библиография, рецензии ; Киприан Карфагенский, епископ, священномученик ; Сомань Х. Минней Р. [Рец. на кн.: ... Ключевые слова: библиография, рецензии ; Библия: Новый Завет ; Библия (переводы) . ... Ключевые слова: библиография, рецензии ; Библия: Новый Завет (Евангелия) ; Глубоковский Н.Н., профессор ; Лука, апостол от 70-ти, евангелист . ... Ключевые слова: библиография, рецензии ; Библия: Новый Завет (Евангелия) ; Антонов В.В. Григорий (Лебедев), епископ Шлиссельбургский . ...

Еще в разделе: (Показать все результаты (>74) - www.srcc.msu.ru/ )

• http://www.srcc.msu.ru/bib_roc/bib/ItemsT53.htm
• http://www.srcc.msu.ru/bib_roc/bib/ItemsT56.htm
• http://www.srcc.msu.ru/bib_roc/bib/ItemsA1158.htm

... A comparative study of thermodynamic for both natural and artificial RNA/DNA ­ protein complexes would establish bases for a specificity of complex formation. In particular, we have shown that aptamers could be used for a direct measuring of thrombin enzymatic activity in a solution. D 2002 Published by Elsevier Science B.V. Keywords: RNA/DNA ­ protein interactions; Ribosome; SELEX; RNA/DNA aptamers; Thrombin; Enzymatic activity 1. ... The aptamer binds to the protein with Kd = 0.5 nM. ...

Еще в разделе: (Показать все результаты (>7) - rnp-group.genebee.msu.ru/ )

Bird Species Database (BSD) is being compiled in a framework of the Arctic Birds Breeding Conditions Survey (ABBCS) of the International Wader Study Group (IWSG). BSD aims at providing information on distribution, numbers and breeding status of birds in the Arctic, with the focus on last-breaking and, thus usually unpublished information. The primary source of data is questionnaires filled in by contributors to the ABBCS, while data from literature are being added occasionally. ... breeding . ...

Еще в разделе: (Показать все результаты (>3) - arctic.ss.msu.ru/ )

Irena Lasiecka ( University of Virginia ) . Nikolai Melnikov (CEMI / MSU) . Mikhail Zelikin (MSU / Steklov Institute) . G. Avalos ( University of Nebraska , USA ) . V. Borisov (MSU, Moscow) . ... O. Emanouvilov ( Colorado State University , USA ) . A. Fursikov (MSU, Moscow) S. Hansen ( Iowa State University , USA ) R. Hildebrand ( Joseph Fourier University , France) V. Komornik ( University of Strassburg, France ) A. Kowalewski ( Institute of Automatics, Poland ) . ... Moscow) . ...

Еще в разделе: (Показать все результаты (>3) - oc.cs.msu.su/ )

... Structure, properties, and probable physiological role of small heat shock protein with molecular mass 20 kD (Hsp20, HspB6). ... This review is devoted to critical analysis of data concerning the structure and functions of small heat shock proteins with apparent molecular mass 20 kD (Hsp20). We describe the structure of Hsp20, its phosphorylation by different protein kinases, interaction of Hsp20 with other small heat shock proteins, and chaperone activity of Hsp20. ...

Еще в разделе: (Показать все результаты (>77) - biochem.bio.msu.ru/ )

• The pivotal role of the beta 7 strand in the intersubunit contacts of different
• [Different domain organization of two main conformational states of
• Different neuronal Na(+)/K(+)-ATPase isoforms are involved in diverse signaling

... Antal , T.K., Volgusheva , A.A., Kukarskih , G.P., Krendeleva , T.E., Rubin, A.B. Relationships between H 2 photoproduction and different electron transport pathways in sulfur-deprived Chlamydomonas reinhardtii (2009) International Journal of Hydrogen Energy, 34, pp. ... Antal , T.K., Volgusheva , A.A., Kukarskikh , G.P., Krendeleva , T.E., Tusov , V.B., Rubin, A.B. Examination of chlorophyll fluorescence in sulfur-deprived cells of Chlamydomonas reinhardtii (2006) Biofizika ., 51 (2), pp. ...

Еще в разделе: (Показать все результаты (>5) - biophys.msu.ru/ )

docs ]] . CompHEP . Trace: docs . ... E.E.Boos, M.N.Dubinin, V.A.Ilyin, G.V.Jikia, A.E.Pukhov, S.F.Sultanov, Associated Higgs boson production in $\gamma e$ collisions, Puzzles on the Electroweak Scale. ... E.E.Boos, M.N.Dubinin, V.F.Edneral, V.A.Ilyin, G.V.Jikia, A.E.Pukhov, V.I.Savrin, S.A.Shichanin, S.F.Sultanov, Physics on future $\gamma p$ and $\gamma e$ colliders at TeV energy scale and computer system CompHEP, DESY report 91-114, Hamburg, 1991, 24p . ... Higgs boson production . ...

Еще в разделе: (Показать все результаты (>18) - comphep.sinp.msu.ru/ )

• extra:model:main [CompHEP]

... site navigation | footer (site information) . IChO-2007 Participation Problems IChO RUSSIA Sponsors search . ... Moscow-1996 | ... Chemistry Department | ... Homepages of National Competitions Other International Science Olympiads Previous IChO's Miscellaneous Chemistry sites . ... Some fresh information is available. A letter from the President of 39th IChO . ... Information about post-Olympiad tour is now available . ... Information about guides of 39th IChO is now available. ...

Еще в разделе: (Показать все результаты (>2) - icho39.chem.msu.ru/ )

Journals . ... American Chemical Society . ... Journals , including: Biocatalysis and Biotransformation; Chemical EngineeringCommunications; Chemistry Biology; Chemistry and Ecology; CurrentOpinion in Biotechnology; Current Opinion in Chemical Biology; CurrentOpinion in Colloid Interface Science ; Current Opinion in Solid State Materials Science ; Current Opinion in Structural Biology; CombustionScience and Technology; Ferroelectrics; Folding Design; ID dailyhighlights ... Science . ...

Еще в разделе: (Показать все результаты (>29) - www.kge.msu.ru/ )

• Научная информация
• Archive
• Семинар "Озон и другие экологически чистые окислители" -

... БИБЛИОТЕКА НИИЯФ МГУ . ... Полный список журналов ELSEVIER и SpringerLink доступных в 2011 году . ... Электронные ресурсы НИИЯФ МГУ . ... Acta Physica Hungarica, New Series, Heavy Ion Physics . ... Applied Physics Letters . ... аннотации . ... Astrophysical Journal, Astrophysical Journal Letters, Astrophysical Journal Supplement series . ... Journal of Physical Chemistry A . ... The European Physical Journal - Applied Physics . ... The European Physical Journal E: Soft Matter and Biological Physics ...

192. http://shamolin2.imec.msu.ru/art-185-2.pdf

193. ASSESSMENT OF SOIL SUSTAINABILITY TO ACID DEPOSITION

194. Aleksei Zheltikov

195. ВМиК - Online! : Работа для выпускников и студентов ВМК МГУ - Вакансии компании

196. Supernova 1999an in IC 755

197. http://www.mse-msu.ru/Nekipeliv_31012011.pdf

198. Факультет иностранных языков МГУ. Центр Дистанционного обучения.

199. http://www.fbm.msu.ru/sci/sno/FLYER%20Summer%20Course%202011.pdf

200. http://cytol.bio.msu.ru/docs/Information%20letter%202014-1.doc