... Doronina L. , Volodin I., Volodina E. The arousal-related shifts in call characteristics of the defeated great gerbils Rhombomys opimus // 6th International Zoo and Wildlife Research Conference on Behaviour, Physiology and Genetics, Berlin, IZW, 2007, p. 77. ... Sibling aggression in lynx: traits and consequences // Advances in Ethology 38, Supplements to Ethology. ... Advances in Ethology, Contributions to the 5-th International Symposium on Physiology, Behaviour and Conservation of Wildlife. ...

Еще в разделе: (Показать все результаты (>54) - vertebrata.bio.msu.ru/ )

• Л.П. Корзун
• Выступления студентов и аспирантов на конференциях

Geometric Structures in Integrable Systems Sergey Adzhiev (with Victor Vedenyapin), Entropy for generalised quantum kinetic and Liouville equations. Abstract: In his 1872 paper L. Boltzmann proved H-theorem for a class of kinetic equations. ... Abstract: P. Clarkson and M. Kruskal (1989) proposed a method for finding reductions of partial differential equations with two independent variables. ... Gennady El, Kinetic equation for a soliton gas ­ a new integrable system? ...

Еще в разделе: (Показать все результаты (>70) - new.math.msu.su/ )

• http://new.math.msu.su/content_root/programs/kaf/special/matan/teor-koz.doc
• http://new.math.msu.su/content_root/programs/kaf/special/terver/neksovr-afan.doc
• http://new.math.msu.su/Sites/demosite/Uploads/roaz.978E555EE90844F3B38BFC97BCDC69F3.pdf

ISSN 0145 8752, Moscow University Geology Bulletin, 2013, Vol. ... On the Mechanism of the Generation of Seismic "Nails" V. S. Zakharov Faculty of Geology, Moscow State University, Moscow, 119991 Russia e mail: vszakharov@yandex.ru Received March 11, 2013 Abstract--The spatial and temporal peculiarities of seismic "nails" are analyzed. Some nails are related to strong earthquakes, or volcanic eruptions, while some do not show any coincidence with any fault zone or other tectonic structures. ...

Еще в разделе: (Показать все результаты (>22) - dynamo.geol.msu.ru/ )

• http://dynamo.geol.msu.ru/personal/vsz/posters/nlob/nlob2.html
• http://dynamo.geol.msu.ru/personal/vsz/papers/Lubnina_etal_2015_eng.pdf
• http://dynamo.geol.msu.ru/personal/vsz/papers/Zakharov_etal_2015_eng.pdf

... Alexey Andreev БЂ“ Deputy Dean of the General Affairs and Strategic Development of the Faculty of Global Studies MSU, Associate Professor . ... School of Young Specialist at International Relations and preparatory courses of the Faculty of Global Studies are running. п п°п±пѕя‚п°пµя‚ я€пєпѕп»п° яЋпЅпѕпЕпѕ пјпµп¶пґяѓпЅп°яЂпѕпґпЅпёпєп° пё пїпѕпґпЕпѕя‚пѕпІпёя‚пµп»яЊпЅя‹пµ пєяѓяЂяЃя‹ я„п°пєяѓп»яЊя‚пµя‚п° пЕп»пѕп±п°п»яЊпЅя‹я… пїяЂпѕя†пµяЃяЃпѕпІ пјпЕяѓ . ... Home Search results for ' ' (Page 389) . ...

Еще в разделе: (Показать все результаты (>1575) - fgp.msu.ru/ )

• п пµп·яѓп»яЊя‚п°я‚я‹ пїпѕпёяЃпєп° п¤п“пџ пњп“пе пёпј. пњ.п’.

The Department of Talented Youth Affairs and Professional Orientation . ... Olympiads . ... All-army olimpiad . ... Olympiad for School Pupils . ... Olympiad for school pupils was held in 2005 under the motto ?Via scientiarum?, which means ?The way to the knowledge? in Latin. ... The 46 th Mendeleev International Olympiad in Chemistry for School Pupils was held in Kazakhstan in the 2011-2012 school year. ... 2016 - The Department of Talented Youth Affairs and Professional Orientation ...

Еще в разделе: (Показать все результаты (>26) - talant.msu.ru/ )

Doxyfile 1.4.6-NO # This file describes the settings to be used by the documentation system # doxygen (www.doxygen.org) for a project # # All text after a hash (#) is considered a comment and will be ignored # The format is: # TAG = value [value, .. ... USE_WINDOWS_ENCODING = YES # If the BRIEF_MEMBER_DESC tag is set to YES (the default) Doxygen will # include brief member descriptions after the members that are listed in # the file and class documentation (similar to JavaDoc). ... The default is NO. ...

Еще в разделе: (Показать все результаты (>10) - imaging.cs.msu.ru/ )

• http://imaging.cs.msu.ru/files/courses/ipintro2012/sample_code.m

... The two main ways of financing a business, equity financing and debt financing, will be discussed in this chapter. Equity Financing Equity capital is the amount of money that you and/or your partners put into the business or raise from other investors. Equity is not debt. While investors share in the profits (or losses) of the business, their investment is not a loan. ... Debt Financing With your equity capital in place, you are now in a position to approach lenders for a business loan. ...

Еще в разделе: (Показать все результаты (>37) - innovation.msu.ru/ )

• Start-Up Company Development :: Управление инновационной политики и организации

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>16) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• Nhunt: program for nucleic acid sequence similarity search

... Research group of Prof. Igor V. Pletnev | ... Research group of Dr. Natalia Shvedene, Laboratory of Electrochemical Methods of Analysis, MSU Chem (ion-selective electrodes, voltammetry) . ... Rzevskaia A.V., Shvedene N.V., Pletnev I.V. Solidified ionic liquid as crystalline sensing element of the bromide selective electrode. ... Shvedene N.V., Belchenko N.N., Starushko N.V., Baulin V.E., and Pletnev, I.V. Liquid membrane electrodes based on aza compounds for the determination of organic aniones. ...

Еще в разделе: (Показать все результаты (>30) - analyt.chem.msu.ru/ )

... В работе показано, что риск вымирания (т.е. отношение P/(1-P), где P - вероятность вымирания) есть степенная функция массы тела с показателем степени примерно 0.75. Поскольку средняя численность млекопитающих убывает как масса тела с показателем степени -0.75, получается, что риск вымирания у крупных видов (по сравнению с мелкими) возрастает примерно в той пропорции, в которой убывает их численность. ...

Еще в разделе: (Показать все результаты (>29) - ecology.genebee.msu.ru/ )

• http://ecology.genebee.msu.ru/3_SOTR/CV_Terekhin_publ/2009_Bonferroni_deMeeus.doc
• http://ecology.genebee.msu.ru/3_SOTR/CV_Terekhin_publ/2004_Dimorph_HumBiol.pdf
• http://ecology.genebee.msu.ru/3_SOTR/CV_Terekhin_publ/2000_Fecundity_ProcRoySoc.pdf

... ICONO Invited Speakers . ... Gennadiy Kulipanov, Budker Inst. of Nuclear Physics, Russia . ... Marlan Scully, Texas A&M Univ., ... Andrey Goncharov, Inst. of Laser Physics, Russia . ... Vladimir Trunov, Inst. of Laser Physics, Russia . ... Since 1987, he has worked at the National Research Council of Canada (Ottawa) in the field of laser physics and trapped ion optical frequency standards. ... Alexey Taichenachev , Inst. of Laser Physics, Russia . ... S. Vatnik, Inst. of Laser Physics, Russia . ...

Еще в разделе: (Показать все результаты (>11) - iconolat13.phys.msu.ru/ )

• Exhibit
• Registration info
• Excursions

Prague, August 16, 2006 . ... We can decide to merge the GCVS with automatic surveys now. I have already outlined the difficulties and will give some examples illustrating the problems slightly later. Steve Kawaler's suggestion: 'The GCVS personnel might play a role as a `meta-catalog' - a central `index' of survey-based catalogs of variable stars'. ... If we want to have a good meta-catalog, the difficulties I have mentioned in relation to merging the catalogues still should be considered. ...

Еще в разделе: (Показать все результаты (>110) - sai.msu.ru/ )

• А С Т Р О К У Р Ь Е Р
• Дорогие коллеги
• General Catalogue of Variable Stars: Variability Types

Space Weather . ... Models . Data . ... Space Weather Analysis Centre of SINP MSU provides information about the current state of near-Earth's space. Information Services ( SWX ) on the website of the center provide access to current data describing the level of solar activity, geomagnetic and radiation state of the magnetosphere and the heliosphere in the real time. For data analysis, the models of the space environment, working in off-line as well as on-line mode have been implemented. ...

Еще в разделе: (Показать все результаты (>5) - swx.sinp.msu.ru/ )

... Т.А. Власова. ... T.A. Vlassova. ... Acta horticularae, 1994, 381, (Proc. of International Symposium on Natural Phenols in Plant Resistance, 13-17 Sept. ... In: Modern fungicides and antifungal compounds 11, Intercept LTD, Andover, U.K.,( Proc of 12th International Symposium, Castle of Reinhardsbrunn, Germany, May 24-29, 1998), P.242-245. ... In: Modern fungicides and antifungal compounds (14th International Symposium, Castle of Reinhardsbrunn/Friedrichroda, Germany, April 25-29, 2004, Abstracts). ...

Еще в разделе: (Показать все результаты (>11) - plantphys.bio.msu.ru/ )

... Laboratory sample measurements are long used worldwide for this purpose. ... The samples were taken from non-polluted site and the pollutants were added in them in the laboratory. ... Further on the degree of saturation was kept up by adding water to the samples daily. ... The chargeability difference between non-polluted sample and other samples increases rapidly during the first week and then the rate of change grows less becoming almost negligible in the end of the measurement time span. ...

Еще в разделе: (Показать все результаты (>53) - geophys.geol.msu.ru/ )

• http://geophys.geol.msu.ru/referenc/DCFLOW.doc
• http://geophys.geol.msu.ru/shevnin/publ/160.pdf
• http://geophys.geol.msu.ru/shevnin/publ/128.pdf

... Only by numerical simulation. ... moment T (K) Dipole moment (D) Experiment Other example: Diffusion constant 200 250 298 350 400 2.40 2.37 2.48 2.59 2.80 2.25 The Distribution functions: radial distribution function 1 g (r) = N t =1 j i N TS N pair ( r - rij ) The Distribution functions: radial distribution function CC def 2 Work mode ­ computer related 1) · Perform simulation , create trajectory file · Calculate properties timestep by timestep 2) · Perform ...

Еще в разделе: (Показать все результаты (>16) - www.elch.chem.msu.ru/ )

• Molecular aspects of solid state and interfacial electrochemistry

... A p P EC Astropar ticle Physics for Europe · Cosmic rays: A large array for the detection of charged cosmic rays ( Auger North) · Gamma rays: A large array of Cherenkov Telescopes for detection of cosmic high energy gamma-rays ( CTA ) · High energy neutrinos: A cubic kilometre-scale neutrino telescope in the Mediterranean (KM3NeT) · Dark matter search: Ton-scale detectors ... A p P EC Astropar ticle Physics for Europe · Cosmic rays: ­ ­ ­ ­ ­ AMS detector launched. ...

Еще в разделе: (Показать все результаты (>7) - tunka.sinp.msu.ru/ )

... Academic Programmes . ... Vestnik CIE (in Russian) . ... Elective Courses . ... The XIX century Russian Literature; . ... Open to all interested students, this course is especially useful for those who are preparing for Certificate examination (upper levels), or engaged in translation and interpreting; for teachers of Russian as a foreign language. The course s ultimate goal is to build a diversified set of skills that will enable students to explore various genres of Russian Media independently. ...

Еще в разделе: (Показать все результаты (>23) - www.cie.ru/ )

• Russian Language Programmes :: Academic Programmes :: CIE
• Center for International Education - News Archive
• Cultural Programmes and Excursions :: Academic Programmes :: CIE

... Alexey D. Neverov . ... Department of Bioengineering and Bioinformatics, Moscow State University. State Scientific Center GosNIIGenetika. ... EDAS human . EDAS mouse . EDAS dog (not availible now) . EDAS rat (not availible now) . To navigate this site please install the latest version of Macromedia Flash Player for Windows or for Linux . If you do not wish to install Flash you could use text pages with less functionality. ...

Еще в разделе: (Показать все результаты (>3) - edas2.bioinf.fbb.msu.ru/ )

• EDAS (human) - Alternative Splicing DataBase.
• EDAS (mouse) - Alternative Splicing DataBase.

Tsunami source parameters versus earthquake magnitude and depth: Monte Carlo simulation Mikhail Nosov and Anna Bolshakova M.V.Lomonosov Moscow State University, Faculty of Physics, Moscow, Russian Federation (m.a.nosov@mail.ru) European Geosciences Union General Assembly 2011 Vienna | ... Among all possible parameters of a tsunami source we consider only those parameters which can be unambiguously calculated from the vertical component of co-seismic bottom deformations. ...

Еще в разделе: (Показать все результаты (>15) - ocean.phys.msu.ru/ )

• http://ocean.phys.msu.ru/courses/geo/lectures-addons/02/2006%20Wood%20et%20al.%2C%20Accretion%20of%20the%20Earth%20and%20segregation%20of%20its%20core.pdf
• http://ocean.phys.msu.ru/courses/geo/lectures-addons/15/2001%20Demorest%2C%20Dynamo%20theory%20and%20Earth's%20magnetic%20field%20.pdf