Search of Novel Crystalline Materials , Study of their Properties and Crystallization Processes . ... The work of group for the search of novel crystalline materials are held at M.V. Lomonosov Moscow State University since 1964. The main aim of investigations are search and study of new promising multifunctional materials with unusual physical properties: ferroelectrics, superionic conductors, nonlinear optical materials, laser crystals, piezoelectrics, etc. ...
... Co-Chairs: Andrius Baltuska (Technical Univ. of Vienna, Austria), Alexei Zheltikov (Lomonosov Moscow State Univ., ... Topics include, but are not limited to, pattern formation in optical systems, novel optical systems for nonlinear dynamics such as quantum dot lasers, hybrid devices, microlasers, fiber lasers; complex dynamics of nonlinear optical systems such as lasers or OPOs; instabilities in semiconductor lasers by injected signal, optical feedback, or multimode dynamics; ...
... Manuscripts submitted to the journal should be divided into the following sections: Title page, Abstract (in Russian and English), Key words (in Russian and English), main manuscript text, list of references, tables, figures and figure captions. ... Full size of the article includes list of references, tables and figures. ... Rich text format (*.rtf) . ... References are given in the text in square brackets; full references are given at the end of the manuscript in the section List of references. ...
[
Текст
]
Ссылки http://www.antropos.msu.ru/vestnic/pravila_eng.doc -- 35.0 Кб -- 08.04.2015
[
Текст
]
Ссылки http://www.anthropos.msu.ru/vestnic/pravila_eng.doc -- 35.0 Кб -- 08.04.2015 Похожие документы
... About the Institute . ... The International Summer School "Computer Technologies of Engineering Mechanical Problems" is a program designed for University students studying different branches of mechanics and engineering. ... The Summer School is organized in the Institute of Mechanics of Lomonosov MSU. ... The tradition of the Summer School arose from the cooperation between the Institute of Mechanics of Lomonosov MSU and Chien Hsin University of Science and Technology, Taiwan ( www.uch.edu.tw ). ...
University Satellites and . Space Science Education . ... The computer-based practical stereo measurements training course in the aerospace education for the students of geographical specialities . ... The two main systems are the computer-based stereocomparator supporting visual stereo measurements at the monitor of a personal computer and the research stereo correlation utility for automated measurements of the aerial and satellite images for digital elevation models construction. ...
... Miklukho-Maklaya 16/10, Moscow, 117997, Russia, +7(495)3366455, alexei@nmr.ru . ... Analysis of PS microdistribution in tissues as a function of time after PS injection (topical or oral application) helps to characterize a selectivity of PS accumulation in tumor cells and other tissue structures; to reveal correctly a maximum of time profile of its tumor accumulation and to recognize the features of PS tissue distribution (spatial and temporal) at different ways of PS application. ...
... Laboratories: . Inorganic Materials Sciences . Chemistry of Coordination Compounds . Diagnostics of Inorganic Materials . ... Materials: doped narrow band-gap A4B6 and wide band-gap A2B6 crystals and films for optoelectoronics . ... Analysis (chemical composition) and real structure study are carried out by Auger spectroscopy, Electron microprobe analysis, Spattered Neutral Mass-Spectroscopy, Electron microscopy, X-ray difractometry and by selective chemical etching. ...
... Key words: Mathematical physics, algebraic geometry, quantum groups. ... Major research position at the Higher geometry and topology department of MSU(from 2009) Doctor habilitatus degree in physical-mathematical sciences Адрес: 119991 ГСП-1, г. Москва, Ленинские горы, МГУ, механико-математический факультет, кафедра высшей геометрии и топологии e-mail: dtalalaev@yandex.ru тел: (495) 939 3798 Текущие научные проекты: Семинар по некоммутативной геометрии (ИТЭФ). ... Семинар ИТЭФ . Семинар МГУ . ...
The Department of Talented Youth Affairs and Professional Orientation . ... Older posts . Posted on 09.11.2015 by admin . ... The team competitions Continue reading . Posted in News , Без рубрики | Leave a comment . ... In the 2015/16 Continue reading . ... The festival is organized by the Department of Continue reading . ... Posted on 17.11.2014 by admin . ... Federal Agency for Youth Affairs ?Rosmolodezh?, ... 2016 - The Department of Talented Youth Affairs and Professional Orientation ...
GENERAL INFORMATION . Administration . Organization Division . Information Division . ... Scientific Council D 053.05.76 . The Prof. Ilya Berezin Foundation . Postgraduate Students . Students . ... Scientific Subdivisions | ... 1998-1999 Chemical Enzymology Department, Chemistry Faculty . ... Back . ...
Events About Structure . President Vice-Presidents The Presidium The Board The Council . ... Awards: the Order "For Merit to the Fatherland" of the 4th, 3rd and 2nd degree, two Orders of the Red Banner of Labour, the Orders of the Russian Orthodox Church: the Order of Venerable Sergius of Radonezh of the 1st degree, the Order of Saint Macarius, Metropolitan of Moscow of the 1st degree, the Order of the Holy Prince Daniel of Moscow of the 2nd degree, and medals. ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... Institutes of Chernogolovka . The largest of all the scientific institutions of the center is the Institute of Chemical Physics in Chernogolovka , where fundamental problems of chemical physics are studied: kinetics and mechanisms of chemical and biological processes; processes of combustion, explosion, and polymerization; and mechanisms of elementary reactions involving high energy particles. ... Developments and Technologies . ...
... THE LJUBLJANA SUMMER SCHOOL 2006 . ... THE LJUBLJANA SUMMER SCHOOL 2006 is a new intensive programme open to both undergraduate and graduate students of Business, Economics, and other fields of Social Sciences. The programme was created at the Faculty of Economics in Ljubljana in order to impart knowledge by taking full advantage of our country s unique geographical position: the meeting point of East and West. ... The Summer School s aim is to learn by applying knowledge to real-life situations. ...
Russian version . ... Leninskie Gory 1, Moscow, 119991, Russia . ... The title is: "The development of resonant X-ray reflectivity method near the L2,3 absorption edges for investigations of magnetic multilayers". ... Moscow. ... Russia. ... A. Smekhova, е.ю. Gan'shina, B.S. Roschin, A.D. Gribova, M.A. Andreeva, F. Wilhelm, A. Rogalev, "Structural and Magnetic Studies of [Co 0.45 Fe 0.45 Zr 0.1 /a-Si] N Multilayers", Journal of Spintronics and Magnetic Nanomaterials, 1 (1), pp.11-17 (2012) [pdf] . ...
... You must have cookies enabled to log in to MediaWiki. ... Retrieved from " http://algcourse.cs.msu.su/teachwiki/index.php/Special:UserLogin " . Special page . 93.180.27.85 . Talk for this IP address . Log in . ... 1-й семестр 2015 г. Материалы по системе ejudge . ... Special pages . ... About MediaWiki . ...
HOW DOES CRYSTAL CHEMISTRY PREDICT STRUCTURE AND PROPERTIES OF CRYSTALS V. S. URUSOV Crystal chemistry has created a set of methods and procedures to predict structure and properties of crystals. ... З. л. мкмлйЗ еУТНУ,ТНЛИ ,,УТЫ ТЪ,ВММњИ ЫМЛ,В ТЛЪВЪ ЛП. е.З. гУПУМУТУ, ї м ЫТУ, З.л., 1997 . ... мкмлйЗ З.л. дДд дкалнДггйпаеаь икЦСлдДбхЗДЦн лнкмднмкм.. ... 1 мкмлйЗ З.л. дДд дкалнДггйпаеаь икЦСлдДбхЗДЦн лнкмднмкм а лЗйвлнЗД дкалнДггйЗ 43 . ... Ti4+ 2 -, 1 : 2 , . 2 --2 - Ti4+-Ti4+) , (2 --Ti4+). ...
... Trimodal nanoporosity of porous glasses . ... Polymodal nanoporosity of porous glasses with normal type of light scattering was studied by two new methods: a kinetic method of diffusion diagnostics (DD-method) and an equilibrium method of gas desorption at low partial pressures (LPED-method). The computer fitting of diffusion and equilibrium desorption isotherms of nitrogen, oxygen and argon at 77.5 K revealed the availability microporous substructure in mesoporous materials. ...
Научная Библиотека . Отдел Обслуживания Физического Факультета МГУ . ... ICES Journal of Marine Science: Journal du Conseil . ... Immunological Reviews . ... Industrial & Engineering Chemistry Research . ... International Journal of Impotence Research . ... International Journal of Management Reviews . ... International Journal of Public Opinion Research . ... International Journal of Urban and Regional Research . ... Научная Библиотека Физического факультета МГУ имени М. В. Ломоносова . ...
Moscow Astronomical Plate Archives: . Contents, Digitization, Current and Possible Applications . ... We describe the astronomical plate archives in Moscow and Zvenigorod and the existing digitization projects. ... 2 The Plate Archive of the Sternberg Institute . The contents of the most important Moscow astronomical plate archive, that of the Sternberg Astronomical Institute, was briefly presented in Shugarov et al. [1] in 1999. ... THE MOSCOW PLATE COLLECTION (STERNBERG INSTITUTE) . ...