Department of Physics, Lomonosov Moscow State University . ... E: This email address is being protected from spambots. You need JavaScript enabled to view it. ... Division of Atomic Physics, Plasma Physics, and Microelectronics . ... Faculty of Physics . ... Atomic Physics, Plasma Physics, and Microelectronics Division . ...

Еще в разделе: (Показать все результаты (>37) - cryolab.phys.msu.ru/ )

• Denis E. Presnov
• Devices based on LTS and HTS
• Probe microscopy

... Nonlinear fiber optics . ... member of the Editorial Board for the Laser Physics journal . ... Member of the steering committee of the international conference on Raman spectroscopy (ICORS): Budapest, 2002; Brisbane, 2004; Yokohama, 2006; London, 2008 . Member of the steering committee of the International Laser Physics workshop: Bratislava, 2002; Hamburg, 2003; Trieste, 2004; Kyoto, 2005; Lausanne, 2006; Leon, 2007; Trondheim, 2008; Barcelona, 2009 . ... International conference ?Laser Optics? ...

Еще в разделе: (Показать все результаты (>15) - photonicslab.phys.msu.ru/ )

• E. E. Serebryannikov
• Collaborations
• Contacts

Today @ Colorado State University Page 1 of 2 Return Home Research finds circadian rhythms dominate all life functions, plays significant role in metabolism June 20, 2007 New research from Colorado State University shows that the function of all genes in mammals is based on circadian - or daily - rhythms. ... The new study presents oscillation as a basic property of all genes in the organism as opposed to special function of some genes as previously believed. ...

Еще в разделе: (Показать все результаты (>498) - chronos.msu.ru/ )

• http://temporology.bio.msu.ru/EREPORTS/shulman_important.pdf
• http://temporology.bio.msu.ru/EREPORTS/PeriodicEng.pdf
• Quantitative methods of ecological control:

... Faculty of Physics . M.V.Lomonosov Moscow State University . 7 (495) 939-16-82 info@physics.msu.ru . ... Contacts . ... Education . ... Giving to physics faculty . Alumni / Giving to physics faculty . GIVING TO THE FACULTY . ... Please transfer the donations to the special account of the Faculty of Physics, details of which are given below: . ... INN 7729182048 Faculty of Physics of Moscow State University . ... DONATION to the Faculty of Physics. ... Faculty of Physics, 2016 . ...

Еще в разделе: (Показать все результаты (>87) - www.phys.msu.ru/ )

• Alumni Association
• Library of the Faculty of Physics
• Calendar

.. LOMONOSOV MOSCOW STATE UNIVERSITY , . 1, , -1, 119991 .: 8 (495) 939-10-00, : 8 (495) 939-01-26 07.09.2010 . ______________________ Leninskie Gory, Moscow, 119991, Russia Tel: 7 (495) 939-10-00, fax: 7 (495) 939-01-26 07.09.2010 . Re: _____________________ , .. ! .. 70- . , , , , . , , , . , . , . , , . , , , , , . , .. - ..

Еще в разделе: (Показать все результаты (>6) - www.eau.msu.ru/ )

• http://www.eau.msu.ru/files/informacionnoe_pismo_.doc

. [Russian] .. Education, . Research Interest . Scientific Achievements . My Teachers . Parachute Science . Parachute Equipment . Margarita Dzhalalova . Ph.D. (Phys.& Math.), Senior Research Scientist . Address: . Institute of Mechanics . M.V. Lomonosov Moscow State University . 1 Michurinsky pr. Moscow 119192, Russia . E-mail: . margarita-vd@mail.ru . Copyright & Design 2001 by M. Dzhalalova . М.B. Джалалова

Еще в разделе: (Показать все результаты (>8) - margaret.imec.msu.ru/ )

• teachers
• Education

... MSU Chamber Orchestra . ... 6.30 p.m. M.V. Lomonosov Moscow State University . ... at the 31 st floor of the Main building . The Music Evenings at the 31 st floor" . ... Alexander Konstantinov, music director . ... Nilufar GOIBOVA ( soprano ) . ... Moscow State University . The Main building at Vorob'evy Gory ('University' metro station) . ... Culture Centre of Moscow State University . ... ADDRESS: Main building of Moscow State University at Vorobjovy Gory (metro station "Universitet") . ...

Еще в разделе: (Показать все результаты (>25) - music.genebee.msu.ru/ )

• MSU Chamber Orchestra. Index.

SUNY-MSU Partnership . ... MSU | ... The State University of New York/Moscow State University partnership dates back to the mid-1970s and owes its existence to the vision of then MSU Rektor Rem Kokhlov and SUNY Chancellor Ernest L. Boyer. ... The first students were exchanged in 1977. ... A SUNY Center on Russia and the United States opened its doors in January 2000, and a sister MSU Center on the United States and Russia was set up in Moscow at MSU?s newly built Science Park. ... suny-msu . ...

Еще в разделе: (Показать все результаты (>2) - www.suny.msu.ru/ )

• SUNY-MSU: Center on Russia and the United States

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>17) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

... Research . ... Welcome to the website of the Laboratory of Chemical Thermodynamics of Lomonosov Moscow State University! ... Prof. Gennady F. Voronin . ... The laboratory wasљestablished by Prof. Adam V. Rakovsky first as a "halurgy laboratory" in 1930. Later in 1934, itљwasљrenamed "Laboratory of Chemical Thermodynamics". ... Colloquium on 24.12.12 20 Dec 2012 . ... Department of Chemistry . ... Laboratory of Chemical Thermodynamics . ... 2000-2016 Laboratory of Chemical Thermodynamics . ...

Еще в разделе: (Показать все результаты (>95) - td.chem.msu.ru/ )

• Awards and Prizes Laboratory of Chemical Thermodynamics
• Ilya B. Kutsenok Laboratory of Chemical Thermodynamics
• Gennady F. Voronin Laboratory of Chemical Thermodynamics

Faculty of Physics of Lomonosov Moscow State University . ... Department of Photonics and Microwave Physics is one of the largest departments of Faculty of Physics of Lomonosov Moscow State University . ... Our department holds annual conference on wave phenomena in nonhomogeneous media, physics and applications of microwaves in May in Moscow suburb. ... Physics of microwaves . ... Department of Photonics and Microwave Physics . Faculty of Physics . Lomonosov Moscow State University . ...

Еще в разделе: (Показать все результаты (>3) - photonics.phys.msu.ru/ )

Solid State Physics Chair and Magnetism Department of M.V.Lomonosov Moscow State University . Joint RFBR-Helmholtz grant "Defects in magnetic TiO2" ("DETI.2") (HRJRG-314 & RFBR #12-02-91321-SIG_a"; 01.02.2012 - 01.02.2015): . DETI.2 (English) . ... Midterm Workshop at Moscow State University: . October 9th - 14th 2013, Moscow, Russia . ... Kay Potzger (HZDR): "Diluted magnetic semiconductors and oxides - resurrection"; . ... 19h30 - 22h30: joint Workshop Dinner on the Moscow-river; . ...

Еще в разделе: (Показать все результаты (>979) - magn.phys.msu.ru/ )

• Collaboration

<