... Магистерское образование . ... Магистерские программы . ... This is an obligatory course for 1-year students, studying for the magisterial degree ?Open Information systems? and ?Network software?. ... Are researched the most frequently used applied protocols of net security and protocol of creating virtual private nets. ... This is an obligatory course for 1-year students, studying for the magisterial degree ?Program devices of net?. ... Магистратура: master@cmc.msu.ru, 3-й этаж, комната 360, тел. ...

Еще в разделе: (Показать все результаты (>9) - hcs.cmc.msu.ru/ )

... О проекте . ... The possibility of the creation and the application prospects of the laser-electron X-ray generator based on Thompson scattering of laser radiation on a bunch of relativistic electrons are considered. ... The layout of beam-lines and experimental stations intended for the applications of the X-ray laser-electron generator to the investigation of the elemental composition, material structure and biological objects is discussed. ...

Еще в разделе: (Показать все результаты (>4) - miles.sinp.msu.ru/ )

Серверные функции OS/2 . ... Если вы еще не вошли (не зарегистрировались) в системе, то надо запустить "Peer Workstation Logon" и в появившемся окне набрать свое имя (User ID) и пароль (Password). Находим и запускаем "Sharing and Connecting" . ... Например, выберем директорию UTIL на диске D: . ... Определим доступ к вашему ресурсу, нажмите кнопку "Grand access". ... Read only - только чтение . ... В окне "Sharing and Connecting" появится общий ресурс, при необходимости можно создать еще. ...

Еще в разделе: (Показать все результаты (>16) - www.kge.msu.ru/ )

• OS/2 Клиент в сети Microsoft

... Purpose of cooperation : Creating the collection of world flora for education, research and conservation Ссылки на публикации: http :// www.botsad.msu.ru Reference to publications : http :// www.botsad.msu.ru Контакты: Раппопорт Александр Витальевич, заместитель директора ботанического сада биологического факультета МГУ имени М.В. Ломоносова, кандидат биологических наук e-mail: info@bg.msu.ru ... Rare, endangered species of plants and Red Books (National and regional). ...

Еще в разделе: (Показать все результаты (>85) - www.msu.ru/ )

• http://www.msu.ru/work/2010/samsung1.pdf
• Faculty of Fine and Performing Arts
• MSU Web Sites

Cassa depositi e prestiti spa Long-Term Instruments for financing Infrastructure Franco Bassanini Chairman of Cassa Depositi e Prestiti Institute of the Russian Academy of Sciences September 22, 2010, Moscow Cassa depositi e prestiti spa Global capitalism and short-termism · The short-termism that characterized recent global capitalism had negative effects on the ...

Еще в разделе: (Показать все результаты (>19) - www.mse-msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>5) - mouse.genebee.msu.ru/ )

MATSYM - symbolic matrix processor . ... To use the program you will need a MAT file (liked CIR file: "User manual for CIRSYM program") of your system. ... In first string of MAT file enter any text you want to be the title of your system. ... Starting from string 2 (if is not comments - "*") enter the system element name, incident row and column and, optionally, its value. ... To generate a solution, run MATSYM.exe and enter "system_file_name.CIR" or click on the "ENTER" (in "MAT" case). ...

Еще в разделе: (Показать все результаты (>10) - astrometric.sai.msu.ru/ )

• Symbolic circuit processor
• Complex evaluator

4 SPIN. ... 0 1 Hello, world! ( ) ";" , active proctype main() { printf("Hello, world!\n") } ­ , >spin hello.pml Hello, world! 1 process created Hello, world! ... mtype = { P, C }; mtype turn = P; active proctype producer() { do :: ( turn == P) - printf( Produce\n ); turn = C od } active proctype consumer() { do :: ( turn == C) - printf( Consume\n ); turn = P od } ( 1) ­ 0, (op on sequence) (guard) ­ mtype = { P, C }; mtype turn = P; active proctype producer() { do :: ( ...

Еще в разделе: (Показать все результаты (>3) - savenkov.lvk.cs.msu.su/ )

• http://savenkov.lvk.cs.msu.su/mc/lect02.pdf

SELECT data_key, data_value FROM xf_data_registry WHERE data_key IN ('options', 'languages', 'contentTypes', 'codeEventListeners', 'cron', 'simpleCache', 'routesPublic', 'bannedIps', 'styles', 'nodeTypes', 'smilies', 'bbCode', 'displayStyles', 'trophyUserTitles', 'reportCounts', 'moderationCounts') . ... Select Type . ... Ref . ... SIMPLE . ... PRIMARY . ... const . ... library/XenForo/ Autoloader.php . ... library/Zend/Registry.php . ... library/Zend/Config.php . ... library/Zend/Db/Select.php . ...

Еще в разделе: (Показать все результаты (>25) - osk.msu.ru/ )

• http://osk.msu.ru/forum/members/adollekautoto.2142/?_debug=1
• http://osk.msu.ru/forum/members/arbimeorirm.2192/?_debug=1
• http://osk.msu.ru/forum/members/catyfopwbex.2168/?_debug=1

... Electronic journal Issue 4. 10 september 2004 Vorontchuk, Cox III R.W. Developing a Competency-based Career Training and Professional Development Program for Latvia INTRODUCTION. ... With the support of a grant from the NISPAcee a team from the Latvian School of Public Administration, the University of Latvia and the University of Akron (Ohio, USA) prepared for the Chancellery of Latvia a proposal for the creation of a career-long professional development program for those in the civil service. ...

Еще в разделе: (Показать все результаты (>7) - e-journal.spa.msu.ru/ )

• http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./leigh.pdf
• http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./paliulis_chlivickas.pdf
• http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./bonham_surin.pdf

... Specialist degree . ... Master degree . ... Master variants . ... About Faculty . ... Mechmath faculty admission resumed its work and is actively preparing for the new reception 2015! ... Read more about Schedule in June . ... The Dean of Mechanics and Mathematics Faculty, the head of the Department of Mathematical and Computer Analysis Methods, professor Vladimir Chubarikov ; . ... Read more about The Open Day . ... 2016 Mechmath admission for internetional students ...

Еще в разделе: (Показать все результаты (>8) - pk.math.msu.ru/ )

• About Mathematics and Mechanics Faculty | Mechmath admission for internetional
• IX Festival of Science | Mechmath admission for internetional students
• information | Mechmath admission for internetional students

... However, our studies show that Prosilica EC650 has very good p erformance to use as DIMM image detector. ... The sub-directories /opt/dimm/data/out for the output data file, /opt/dimm/data/log for the output log file yymmdd-dimm.log and /opt/dimm/etc for the configuration file must b e created. ... Pictures mode The Pictures mode provides grabbing of the star b ox images and storing their sequence as one output file "b oxrecord.fits" in /opt/dimm/data/images/ sub directory. ...

Еще в разделе: (Показать все результаты (>35) - curl.sai.msu.ru/ )

• http://curl.sai.msu.ru/mass/download/doc/infrasoft_eng.pdf
• http://curl.sai.msu.ru/mass/download/doc/massug.pdf
• http://curl.sai.msu.ru/mass/download/doc/massug_eso.pdf

Home . Database of structures of nucleic acid - protein complexes . ... List of complexes . Pfam families . SCOP families . Interaction classes . ... NPIDB . ... Information on SCOP and Pfam domains detected in protein chains is presented. ... Each family has its own web page with the list of entries that include domains of the family. ... List of SCOP domains occurred in DNA-protein and RNA-protein complexes is organized in tree-like form, according to the SCOP classification. ...

Еще в разделе: (Показать все результаты (>88) - npidb.belozersky.msu.ru/ )

Academic English English for Students of Mathematics and Mechanics Supplementary Exercises Part II L.N.Vygonskaya O.Y.Sviridenko MSU Moscow 2012 Academic English (part 2 of 4) The tasks are based on «English for Students of Mathematics and Mechanics» by Y.I. Mindeli. Unit 1 Task 18. ... 1 Armer, T. Cambridge English for Scientists, Cambridge, 2011 4 Academic English (part 2 of 4) Unit 7 Midterm test Unit 8 (At home) Make up a list of linking words you know and bring it to class. ... Task 15 p.93. ...

Еще в разделе: (Показать все результаты (>16) - www.eng.math.msu.su/ )

• http://www.eng.math.msu.su/download/Abstract2014.pdf

... Les programmes d?enseignement . ... La page principale > Les programmes d?enseignement > . S?minaires options d??t? . ... le russe des affaires; . ... Les tudiants liront et analyseront des chef-d oeuvres de la po sie russe du ХIХ ХХ mes si cles; ils mettront les spectacles en sc ne et participeront galement aux mini-spectalces fond s sur la base de ce qu ils ont lu. ... Vous apprendrez le vocabulaire professionnel et les structures grammaticales, les plus communes dans le russe d affaires. ...

Еще в разделе: (Показать все результаты (>29) - www.cie.ru/ )

• Les programmes d?enseignement :: CEI

Thunderstorms and Elementary Particle Acceleration . ... Conference . The first announcement . ... The Thunderstorms and Elementary Particle Acceleration (TEPA-2012) conference is the second one devoted to the studies of the extreme atmospheric effects connected with amplification of electric fields in the lower atmosphere. ... TEPA-2012 conference will be held from July 9 till July 11, 2012, just after the 23rd European Cosmic Ray Symposium also organized by MSU ( http://ecrs2012.sinp.msu.ru ) . ...

Еще в разделе: (Показать все результаты (>2) - tepa2012.sinp.msu.ru/ )

PHYSICAL REVIEW A, VOLUME 61, 052305 Analysis of radiatively stable entanglement in a system of two dipole-interacting three-level atoms I. V. Bargatin, B. A. Grishanin, and V. N. Zadkov International Laser Center and Department of Physics, M. V. Lomonosov Moscow State University, Moscow 119899, Russia Received 29 November 1999; published 7 April 2000 We explore the possibilities of creating radiatively stable entangled states of ... II only two transitions in the whole system. ...

Еще в разделе: (Показать все результаты (>65) - qilab.phys.msu.ru/ )

• http://qilab.phys.msu.ru/papers/PRA22309.pdf
• http://qilab.phys.msu.ru/papers/FortschrPhys-2000-en.pdf

Space Weather . ... Space weather . ... Data . ... You should fill in "Workspace" by groups of data sets to create plots. ... Putting different kind of data into the same plot remember, that the first dropped data set chooses and determines the axis scale for all data. ... If you need both kind of scale in the same plot, create two different plots and unite them. The speed of this service depends on 3 components: data processing on server, data transmission and data plotting in your browser. ...

Еще в разделе: (Показать все результаты (>1226) - swx.sinp.msu.ru/ )

LUT Summer School: www.lut.fi/summerschool summerschool@lut.fi Guide for Student Advisers Greetings from your colleagues at Lappeenranta University of Technology! ... With the wide-ranging selection of courses on-offer during the LUT Summer School we aim to both challenge and inspire students. ... Lappeenranta and LUT Lappeenranta is located some 220 km northeast of Finland's capital, and about 230 km northwest of St. Petersburg, Russia. ... The fee will be given on the LUT Summer School web pages. ...

200. http://qi.phys.msu.ru/kulik/Papers/e011802.pdf