... include stdio.h # include stdlib.h int main( int argc, const char* argv[]) { FILE* f; int c, wordCnt = 0, inWord = 0; if (argc 2) { printf ( Use: %s filename\n , argv[0]); return 1; } f = fopen(argv[1], r ); if (f == NULL) { printf ( Can't open file: %s\n , argv [1]); return 1; } while ((c = fgetc(f)) if (!isspace(c)) if (! inWord ) { ++wordCnt; inWord = 1; } } ... int main() { enum {RUNNING, STOPPED} state; state = RUNNING; state = STOPPED; } RUNNING STOPPED · : 1. ...

Еще в разделе: (Показать все результаты (>2) - savenkov.lvk.cs.msu.su/ )

• http://savenkov.lvk.cs.msu.su/mc/lect04.pdf

... Scientific Effort . ... Cosmic ray astrophysics . Space Physics . ... Nuclear physics . ... The paper was prepared with contributions from Elena Popova from the Skobeltsyn Institute of Nuclear Physics (Lomonosov Moscow State University) and was published in Scientific Reports. ... Federal State Budget Educational Institution of Higher Education M.V.Lomonosov Moscow State University, Skobeltsyn Institute of Nuclear Physics (SINP MSU), 1(2), Leninskie gory, GSP-1, Moscow 119991, Russian Federation . ...

Еще в разделе: (Показать все результаты (>3) - sinp.msu.ru/ )

... Electronic journal Issue 4. 10 september 2004 Leigh E. Making Learning a Game Introduction. As a university lecturer I enjoy playing games with learning goals in mind. My students are all adults who work in many different roles. ... Their needs include learning how to design activities that will support acquisition of practical skills, extend personal understanding of emotional factors, and improve awareness of factors ­ such as economic, ecological and political aspects of society. ... Play. ...

Еще в разделе: (Показать все результаты (>8) - e-journal.spa.msu.ru/ )

• http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./vorontchuk.pdf

1) Faculty of Soil Science, Moscow State University, Moscow 119899, Russia; . ... We assessed critical loads of acid deposition and their exceedance for soils in the Kola Peninsula using a simple balance method and mapped them within 1.0° · 0.5° longitude/latitude grid cells. ... Terrestrial ecosystems in the north-western Kola Peninsula are particularly susceptible to acid deposition damage due to relatively high soil sensitivity and heavy sulphur deposition. back . ...

Еще в разделе: (Показать все результаты (>35) - eco.soil.msu.ru/ )

• Koptsik G.N., et al. Soils of the National Park "Russian North".

... 2 What is MATLAB ?? Basic Matrix Operations Script Files and M-files Some more Operations and Functions APPLICATIONS: Plotting functions .. ... Vectors are special forms of matrices and contain only one row OR one column. Scalars are matrices with only one row AND one column MATLAB Matrices 17 A matrix with only one row AND one column is a scalar. A scalar can be created in MATLAB as follows: » a_value=23 a_value = 23 MATLAB Matrices 18 A matrix with only one row is called a row vector. ...

Еще в разделе: (Показать все результаты (>9) - imaging.cs.msu.ru/ )

• http://imaging.cs.msu.ru/pub/2013.PRIA.Levashov_Yurin.RidgeAndTree.en.pdf

... ICONO Symposium on Femtosecond Laser Pulse Filamentation . Co-Chairs: Sea Leang Chin (Laval Univ., ... Russia) . ... In the past 15 years, he turned his attention to study the physics and applications of femtosecond laser filamentation in all optical materials, in particular, in air and is one of the leading scientists in this field. ... INVITED : в?? ... Efficient THz generation by optical rectification of femtosecond laser pulses and application of THz radiation for plasma investigation в??, ...

Еще в разделе: (Показать все результаты (>5) - iconolat13.phys.msu.ru/ )

• Invited speakers

... Инструкция по работе с информационными ресурсами в ОРОКС . ... Основные разделы сервера: Выбор раздела сервера ------------------------------------ На первую страницу "ChemNet" ------------------------------------ Химический факультет МГУ ------------------------------------ Электронная библиотека по химии ------------------------------------ Базы данных и другие источники информации по химии ------------------------------------ Периодические издания по химии -- Вестник МГУ. ...

Еще в разделе: (Показать все результаты (>3) - do.chem.msu.ru/ )

... 6:30 - 7:00pm |Transit to Executive Learning | ... 8:00 - 10:00pm |Dinner |Executive Dining Room | ... 10:30 - 10:45am |Funds |Executive Dining Room | Claude Legrand |10:45am - 12:30pm|Refreshment Break |ELC x.206 | ... 10:30 - 10:45am |Refreshment Break |Executive Dining Room | ... Lunch |Executive Dining Room | ... 2:30 - 2:45pm |Refreshment Break |Executive Dining Room | ... 4:00 - 4:15pm |Refreshment Break |Executive Dining Room | ... 5:15 - 5:30pm |Refreshment Break |Executive Dining Room | ...

Еще в разделе: (Показать все результаты (>2) - www.innovation.msu.ru/ )

• http://www.innovation.msu.ru/SEEC-LMSU_Detailed_Program_Itinerary_Nov4-Nov12_2007.doc

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>2) - mouse.genebee.msu.ru/ )

Academic English English for Students of Mathematics and Mechanics Supplementary Exercises Part II L.N.Vygonskaya O.Y.Sviridenko MSU Moscow 2012 Academic English (part 2 of 4) The tasks are based on «English for Students of Mathematics and Mechanics» by Y.I. Mindeli. Unit 1 Task 18. ... 1 Armer, T. Cambridge English for Scientists, Cambridge, 2011 4 Academic English (part 2 of 4) Unit 7 Midterm test Unit 8 (At home) Make up a list of linking words you know and bring it to class. ... Task 15 p.93. ...

Еще в разделе: (Показать все результаты (>17) - www.eng.math.msu.su/ )

... The colleges had gathered a lot of experience in upbringing of young people. ... Keywords: historical anthropology, cultural history, daily city life, women's education, modernisation, school medicine, empress Maria's establishments, closed girls' colleges Strokina A.N., Butareva I.I. Ergonomics measurements of body schoolchildren (p. 30) The article presents the children's body size, intended for the construction of facilities and activities for communities associated with their use of spaces. ...

Еще в разделе: (Показать все результаты (>24) - www.anthropos.msu.ru/ )

• http://www.antropos.msu.ru/vestnic/e2013_1.doc
• НИИ и Музей антропологии | Вестник Московского университета. Серия XXIII.

Red Square at Night . The guide books were wrong when they told me that Moscow is dreary in November. ... The sound stands in contrast with the enormous bustle of Moscow. I teach in the Humanities building, a large rectangular steel and glass mirror just out of the shadow of the skyscraper that symbolizes Moscow State University. Getting in and out of the Humanities building means edging into a fast-moving stream of students and faculty who are hustling to class. ...

Еще в разделе: (Показать все результаты (>5) - suny.msu.ru/ )

... M.V.Lomonosov Moscow State University Department of Physics, . ... 5-th All-Russian Conference . Nitrides of gallium, indium and aluminum: structures and devices " . ... Four All-Russian Conferences "Nitrides of Gallium, Indium and Aluminum: structures and devices" took place in Russia during 2001-2005 (in Moscow and St.-Petersburg). The conferences enjoyed the support from RFBR and the Ministry of Industry and Science. ... Nitrides of Gallium, Indium and Aluminum: structures and devices". ...

Еще в разделе: (Показать все результаты (>2) - www.ccl.msu.su/ )

MOSCOW STATE UNIVERSITY -- Faculty of Biology -- Department of Human Physiology -- . ... Our interest is the secret springs of work of a brain. How can a new idea be born in the brain if the physical environment remains constant? ... What mechanisms of the brain are broken in schizophrenia? ... For this purpose we create brain-computer interfaces (BCI) based on modern methods of computational electroencephalography. ... Department of Human Physiology . ... Former Visitors . ... Former students . ...

Еще в разделе: (Показать все результаты (>49) - brain.bio.msu.ru/ )

Home . Database of structures of nucleic acid - protein complexes . ... List of complexes . Pfam families . SCOP families . Interaction classes . ... NPIDB . ... Information on SCOP and Pfam domains detected in protein chains is presented. ... Each family has its own web page with the list of entries that include domains of the family. ... List of SCOP domains occurred in DNA-protein and RNA-protein complexes is organized in tree-like form, according to the SCOP classification. ...

Еще в разделе: (Показать все результаты (>87) - npidb.belozersky.msu.ru/ )

• Index of /data
• Index of /data/html_scop
• Index of /data/pdb_new

... Likert-type scale response anchors. ... Level of Acceptability . ... Neutral . ... Level of Appropriateness . ... Level of Importance . ... Level of Agreement . ... Somewhat disagree . ... Somewhat agree . ... Never true . ... Rarely true . ... Sometimes but infrequently true . ... Sometimes true . ... Usually true . ... Always true . ... Somewhat true of me . ... Somewhat true of what I believe . ... Priority: . ... Somewhat priority . ... Priority Level . ... satisfied . ... Somewhat satisfied . ...

Еще в разделе: (Показать все результаты (>6) - tukachev.flogiston.ru/ )

• Результаты эксперимента в режиме реального времени

Научно-образовательный центр Геномного секвенирования МГУ . ... Sep 11, 2014, 9:17 AM . Yegor Bazykin attached NGS_supported_list.pdf to Результаты конкурса NGS-проектов . ... Yegor Bazykin deleted attachment NGS_supported_list.pdf from Результаты конкурса NGS-проектов . ... Yegor Bazykin edited Конкурс NGS-проектов . ... Yegor Bazykin created Результаты конкурса NGS-проектов . Jul 5, 2014, 2:53 AM . Yegor Bazykin updated polozhenie.pdf . ... Recent Site Activity | ...

198. Current Projects