... OLYMPIAD of NSC. This letter contains information about scientific contest - Olympiad, which is held yearly in Chernogolovka: a small pictures- que village not far from Moscow, in which the Noginsk Scientific Center (NSC) of the Russian Academy of sciences is situated. The contest is participated by pupils of the 8-th to the 11-th forms and consists in solving problems in physics, astronomy and mathema- tics. The Olympiad is one of interesting traditions of our scienti- fic centre. ...
The Future of GPU Computing Wen-mei Hwu University of Illinois, Urbana-Champaign Agenda · · · · Setting the Context Current Victories Coming Battles Conclusion and Outlook NVIDIA HPC Day Moscow State University 2012 CPUs: Latency Oriented Design · Large caches Convert long latency memory accesses to short latency cache accesses ALU Control ALU ALU · Sophisticated control Branch prediction for reduced branch latency ... NVIDIA HPC Day Moscow State University 2012 ...
[
Текст
]
Ссылки http://ccoe.msu.ru/sites/default/files/presentations/Moscow-Keynote-Hwu-10-22-2012.pdf -- 1614.3 Кб -- 25.10.2012 Похожие документы
Mathematical Finance, Vol. ... September 1920 1922-1925 1925-1927 January 1926 1 October 1927 1937 1 October 1937 1941 28 April 1946 1996 Louis Jean-Baptiste Alphonse Bachelier is born in Le Havre Graduates from secondary school at Caen Father's death Mother's death Bachelier is the head of Bachelier fils Military service Student at Sorbonne Bachelor in sciences at Sorbonne Certificate in mathematical physics Bachelier defends his ... BACHELIER'S PUBLISHED WORKS Books 1. ...
[
Текст
]
Ссылки http://new.math.msu.su/department/probab/spec/Materialy_po_kursam_Tutubalina/Finstat/Bashelie/Bachelier100years.pdf -- 110.7 Кб -- 20.03.2014 Похожие документы
... Electronic journal Issue 4. 10 september 2004 Briedis V. Pareto Structures A great Italian economist Vilfredo Pareto (1848 1923) in his unique economics and sociology studies [1, 2] continuously emphasised the systematic approach, reviewing the society development problems. ... Formal model of Pareto Structure First of all, provide a formal mathematical model adequately featuring the Pareto Structure. ... Indeed, I was primarily interested in the classical (harmonic structure) model at s = 1. ...
[
Текст
]
Ссылки http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./briedis.pdf -- 388.0 Кб -- 06.07.2014 Похожие документы
... Individual SELEX products, aptamers, are small molecules (40100 nt) that have a unique three-dimensional structure, which provides for their specific and high-affinity binding to targets varying from low-molecular-weight ligands to proteins. ... Selection of aptamers binding with a target is the key step in SELEX, as aptamers account for only a small fraction of the initial library (one aptamer per 109 to 1013 molecules) [6]. ... Fourth, modification can increase the aptamer affinity for a target. ...
[
Текст
]
Ссылки http://rnp-group.genebee.msu.su/pdfs/MolBio6_00KopylovLO.pdf -- 375.6 Кб -- 21.10.2002
[
Текст
]
Ссылки http://rnp-group.genebee.msu.ru/pages/pdf/molbio2000.pdf -- 375.6 Кб -- 18.02.2008 Похожие документы
Oleg A. Petrii . ... One can mark out at least four general fields of Petrii's activities. ... During the last decade, Petrii's group started with more detailed molecular level approaches to electrostatic effects in electrode kinetics and also moved to the verification of quantum mechanical theory of charge transfer. ... In recent years Oleg Petrii and his associates investigated the role of different molecular parameters, which affect the kinetics of electrode reactions of various complex species. ...
... Hot though was the night air . Hot though the night air was . Hot as the night air was . Hot although the night air was . ... Harvard University has . At Harvard University . Harvard University, with its . There at Harvard University . ... 21 ... single dialect of American English has ever become dominant. ... they do arrive . they did arrive . did they arrive . have they arrived . ... fell ... have raised . fell ... raised . fell ... have risen . ...
Red Square at Night . The guide books were wrong when they told me that Moscow is dreary in November. ... The sound stands in contrast with the enormous bustle of Moscow. I teach in the Humanities building, a large rectangular steel and glass mirror just out of the shadow of the skyscraper that symbolizes Moscow State University. Getting in and out of the Humanities building means edging into a fast-moving stream of students and faculty who are hustling to class. ...
... Printed in Great Britain 0021-8928/00/$-see front matter SOO21-8928(00)00122-2 ON THE BOUNDARIES OF THE PARAMETRIC RESONANCE DOMAIN-lA. ... A constructive approach is proposed which enables one, in the first approximation, to determine the stability domain in the neighbourhood of a point on its boundary using only information at this point: the values of multipliers, eigenvectors and associated vectors of the monodromy matrix and the first derivatives of the system operator with respect to...
[
Текст
]
Ссылки http://mailybaev.imec.msu.ru/papers/MailybaevSeyranian2000.pdf -- 1108.2 Кб -- 14.06.2005 Похожие документы
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
CONFERENCE on DYNAMICAL SYSTEMS THEORY AND APPLICATIONS December 5-8, 2011. ... If (v , ) are the polar coordinates of a certain characteristic point of the rigid body, is its angular velocity"-- and I and m are the inertia-mass characteristics, then the dynamical part of the equations of motion (including the case of Chaplygin analytical functions of medium action; see below) takes the form v cos - v sin - v sin + 2 = Fx , v sin + v cos + v cos - = 0, I = yN (, , v )s(), where Fx = -s()v 2 /m, > 0. ...
... Ключевые слова: антропология, верхний палеолит, прямое радиоуглеродное (AMS) датирование, Сибирь . ... Балахонова Е.И. В.В. Троицкий и его коллекция в Музее антропологии (стр. ... Экспедиция была организована с целью сбора фаунистического материала и географического исследования территории между озерами Виктория и Танганьика при поддержке Академии Наук и Московского университета. ... Информация о конгрессах, конференциях, симпозиумах 2009-2010 гг. (стр. ...
... Более того, многие считают Магдалину одной из самых приближенных к Иисусу учеников, которую он посвящал во многие скрытые от остальных поучения (см. гностические апокрифы из Наг-Хаммади. ... ИИСУС ХРИСТОС СВЕРХЗВЕЗДА . ... Jesus Christ.. ... I can see where we all soon be . ... Разве ты не видишь, что мы должны знать свое место? ... Why should you want to know? ... This Jesus must die (Jerusalem, Sunday) - Этот Иисус должен умереть (Иерусалим, воскресенье) . ... Hosanna heysanna sanna sanna ho . ...
... Results of experimental and numerical investigations of a permeable round parachute with the stripe-stabilizer, the so called "SAL" parachute - Stabilization of Aerodynamic Loads, are given [1]. ... The parachute canopy attained different shapes from each other depending on the value of reefing ( Fig.1 ). ... As given below some numerical investigations of the stripe-stabilizer reefing influence on the canopy shape, its aerodynamic drag and the tension of radial ribbons are considered. ...
Automorphisms and isomorphisms of Chevalley groups of typ e G2 over lo cal rings with 1/2 and 1/3 E. I. Bunina M.V. Lomonosov Moscow State University Russia, 119992, Moscow, Leninskie Gory, Main Building of MSU, Faculty of Mechanics and Mathematics, Department of Higher Algebra email address: helenbunina@yandex.ru Abstract. ... We describe automorphisms of Chevalley groups of type G2 over local rings with 1/2 and 1/3. ... References [1] Abe E. Automorphisms of Chevalley groups over commutative rings. ...
[
Текст
]
Ссылки http://halgebra.math.msu.su/wiki/lib/exe/fetch.php/staff:bunina:autg2_eng.pdf -- 224.0 Кб -- 13.02.2013 Похожие документы
Chlorophyll Fluorescence in vivo : A Theory (Part I) . Most part of the photosynthetic pigments in phytoplankton cell reside in peripheral pigment-protein complexes of the light-harvesting antenna (I, see Fig. ... From peripheral antenna complexes, excitation is efficiently transferred to core antenna complexes near photosynthetic reaction centers (II, Fig. 1), where it can be used in the primary photochemical reaction of photosynthesis. ... and phytoplankton concentration . ...
Dynamo Theory and Earth's Magnetic Field Paul Demorest May 21, 2001 1 Intro duction The Earth's magnetic field belongs in that class of physical phenomena which are commonplace yet also very complex. ... 3 Single Disc Dynamo Before we dive into the mess of equations and approximations that describe how fluid motion and magnetic field interact, it is useful to demonstrate a very simple system which exhibits dynamo action. ... A system without fluid motion cannot support a magnetic field indefinitely. ...
[
Текст
]
Ссылки http://ocean.phys.msu.ru/courses/geo/lectures-addons/15/2001%20Demorest%2C%20Dynamo%20theory%20and%20Earth's%20magnetic%20field%20.pdf -- 266.6 Кб -- 07.12.2009 Похожие документы
... Basic Linux . ... PCMCIA . Sound . ... CLEVO 8750 running X Window . ... BIOS: Phoenix (256Kb Flash ROM, PnP 1.0a, APM 1.2, LBA) LCD: TFT 13.3" 1024x768 . ... PCMCIA: GL9382; 2x Type II or 1x Type III PC Card slots (with ZV support) . ... Battery: Ni-Mh or Li-Ion . ... Nor X Window neither PCMCIA worked. ... For CLEVO 8750, I found at least two RRs at which X Window works: 62Hz and 70Hz. ... To enable the mouse when working on console use GPM with "-dev/psaux -t ps2" options. ...
Theses of the speech of the President of the Russian Rectors' Union, academician V. A. Sadovnichiy on the Russian and Italian Higher Education Institutes' Rectors Forum "Russia and Italia: the Role of Universities in the Development of Cooperation" 26 September 2011, Moscow State Institute of International relations (University) of the MFA of Russia I am glad to greet the highest audience the participants of the Russian and Italian Higher Education Institutes' Rectors Forum! ...