MaTIS History . MaTIS Chair was founded in 1991. It is incorporated in the Department of Mathematics and Mechanics of the Lomonosov Moscow State University and is the only Russian body offering training of mathematicians in the field of intelligent systems. ... The members of MaTIS Chair have published over 40 monographs, over 100 patents and several hundred scientific articles. ... 08.02.15 A personal page of professor Alexander P. Ryjov is updated . ...

Еще в разделе: (Показать все результаты (>45) - www.intsys.msu.ru/ )

• Intelligent Systems :: Staff :: Ryjov Alexander Pavlovich
• Intelligent Systems :: News
• Intelligent Systems :: Staff :: Nosov Valentin Alexandrovich :: History of

THE LABORATORY OF CHEMISTRY AND PHYSICS OF SENSOR AND SEMICONDUCTOR MATERIALS . Application of ferrites in gas sensors . The principal advantage of ferrite as compared to conventional sensor based on semiconductor materials of metal oxides is the ability to adjust their band structure , the nature of the active sites on the surface , changing the cation composition . ... 2008-2014 Laboratory of chemistry and physics of sensor and semiconductor materials. ...

Еще в разделе: (Показать все результаты (>18) - www.lssm.inorg.chem.msu.ru/ )

• The Laboratory of chemistry and physics of sensor and semiconductor materials |
• Лаборатория химии и физики полупроводниковых и сенсорных материалов | Кузнецова

... Subject to the MOIP Charter both natural and legal persons may become the members of the Society upon paying admission fees and acknowledging the Charter and program documents. ... Persons may be elected as the Society?s full and corresponding members on a show of hands at the Society?s Council (Presidium) meeting if nominated by a section and recommended by at least two full Society?s members. ... The Society?s full members have the following rights: . ... 2015 Moscow Society of Naturalists . ...

Еще в разделе: (Показать все результаты (>2) - www.moip.msu.ru/ )

... include stdio.h # include stdlib.h int main( int argc, const char* argv[]) { FILE* f; int c, wordCnt = 0, inWord = 0; if (argc 2) { printf ( Use: %s filename\n , argv[0]); return 1; } f = fopen(argv[1], r ); if (f == NULL) { printf ( Can't open file: %s\n , argv [1]); return 1; } while ((c = fgetc(f)) if (!isspace(c)) if (! inWord ) { ++wordCnt; inWord = 1; } } ... int main() { enum {RUNNING, STOPPED} state; state = RUNNING; state = STOPPED; } RUNNING STOPPED · : 1. ...

Еще в разделе: (Показать все результаты (>2) - savenkov.lvk.cs.msu.su/ )

miniSTRY OF HEALTHCARE AND SOCIAL DEVELOPMENT RF NORTHERN RESEARCH CENTER NORTH-WEST BRANCH RAMS federal service for hydrometeorology and environment monitoring (rosgidromet) MINISTRY OF HEALTHCARE AND SOCIAL DEVELOPMENT OF ARKHANGELSK REGION territorial administration of federal service for consumers' rights protection Surveillance and human well-being in arkhangelsk region NORTHERN STATE MEDICAL UNIVERSITY [pic] NEWSLETTER of the All-Russian Science-and-Practice ...

Еще в разделе: (Показать все результаты (>23) - www.anthropos.msu.ru/ )

• http://www.antropos.msu.ru/vestnic/pravila_eng.doc
• http://www.antropos.msu.ru/edu/3d.pdf

Educational Technology & Society 10(3) 2007 ISSN 1436-4522 : .. . ... 1995). . ... Education Technology & Society 9(1) 2006 pp. 422-427. [ .., 1993] . ... Education Technology & Society 5(1) 2002, pp 222-243. ... Brusilovsky P., 1995] Brusilovsky P. Intelligent learning environments for programming: The case for integration and adaptation // In: J. Greer (ed.) Proceedings of AI-ED'95, 7th World Conference on Artificial Intelligence in Education, Washington, DC, 16-19 August 1995, AACE, pp. ...

Еще в разделе: (Показать все результаты (>124) - www.psy.msu.ru/ )

• Специализация - 'Психология спорта'. Публикации преподавателей специализации
• The Moscow University Herald. Series 14. Psychology

... UHECR SINP MSU . ... News . ... TUS Ultra high energy cosmic ray detector on-board the Lomonosov satellite . ... According to existing estimations it can be a prominent source of ultra high energy cosmic rays (UHECR). ... In either case, the newly born magnetar is an attractive site for producing ultrahigh-energy cosmic rays (particles with individual energies exceeding 10 18 e V ; UHECRs). ... A new mechanism for the acceleration of ultra high energy cosmic rays (UHECR) is presented here. ...

Еще в разделе: (Показать все результаты (>17) - uhecr.sinp.msu.ru/ )

• Новости КЛПВЭ
• JEM-EUSO
• TLE news

... Using the CFBDSIR wide field survey for brown dwarfs, we identified CFBDSIRJ214947.2-040308.9, a late T dwarf with atypically red J-Ks colour. ... SN 2009ip in NGC 7259 Electronic Telegram No. ... 7.09, [19.0; 2009 Aug. ... Accepted for publication in MNRAS Subjects: High Energy Astrophysical Phenomena (astro-ph.HE) The jet opening angle theta_jet and the bulk Lorentz factor Gamma_0 are crucial parameters for the computation of the energetics of Gamma Ray Bursts (GRBs). ...

Еще в разделе: (Показать все результаты (>14) - master.sai.msu.ru/ )

• Ya.B. Zeldovich All-Moscow Seminar of Astrophysicists

... sought for such use through Elsevier's permissions site at: http://www.elsevier.com/locate/permissionusematerial ARTICLE IN PRESS JOURNAL OF SOUND AND VIBRATION Journal of Sound and Vibration 298 (2006) 471 - 474 www.elsevier.com/locate/jsvi Short Communication Wolfhard Kliema, Alexei A. Mailybaevb,Г, Christian Pommer a copy Conditions revisited for asymptotic stability of pervasive damped linear ... In the case of an indefinite damping matrix, system (1) may be stable or unstable. ...

Еще в разделе: (Показать все результаты (>21) - mailybaev.imec.msu.ru/ )

• http://mailybaev.imec.msu.ru/reviews/Olhoff.pdf

. Important note: all text files produced by the Linux versions of the PC GAMESS/Firefly are in DOS text file format for the compatibility with Win32 OS/2 - based PC GAMESS/Firefly versions. If this causes problems, convert them into Unix text file format using one of the available conversion utilities. The PC GAMESS/Firefly accepts both pure Unix and DOS-style input files. Last updated: March 18, 2009

Еще в разделе: (Показать все результаты (>32) - classic.chem.msu.su/ )

• Firefly and PC GAMESS Related Links
• PC GAMESS/Firefly DOCUMENTATION - Cube files
• Firefly and PC GAMESS Version History

... Plants . ... The study of structural and functional plant systems diversity at different levels (cell-to-biocenotic) will reduce the risk of violating the stability of the living systems in Russian Federation. Russian Federation plays a key role in the preservation and use of raw Arctic potential. The highest spore plants, as an essential component of plant communities in northern Holarctic are involved in the settlement of naked substrates, preservation of permafrost and bogging. ...

Еще в разделе: (Показать все результаты (>3) - depository.msu.ru/ )

ChangeLog for / # # Generated by Trac 0.12.5 # 04/11/16 17:24:36 Sun, 19 Dec 2010 22:44:18 GMT Yashina Ksenia ksenia_yashina@тАж [20:2df48c61bd42] * bacteria.py ( added ) * petri.py ( added ) * scale.py ( modified ) now cells can move,reproduce Sun, 19 Dec 2010 22:42:34 GMT Yashina Ksenia ksenia_yashina@тАж [19:b78c555543a8] * vector.py ( added ) added vector module Wed, 15 ...

Еще в разделе: (Показать все результаты (>11) - kodomo.cmm.msu.su/ )

• http://kodomo.cmm.msu.su/trac/petri_dish/log/?format=changelog&rev=21%3Af55481ff4bb5&limit=100&mode=stop_on_copy
• http://kodomo.cmm.msu.su/trac/petri_dish/log/?format=changelog&rev=2df48c61bd4285de81937c0f4a5d378681374ef7&limit=100&mode=stop_on_copy
• http://kodomo.cmm.msu.su/trac/petri_dish/log/?format=changelog&rev=f55481ff4bb5d82106fc33b82cd2d198ad264c3b&limit=100&mode=stop_on_copy

... О проекте . ... A source of medical x-?rays based on a 50 Mev storage ring and a quasi-?continues picosecond laser is considered. It is shown that such generator produces useful X-?ray flux with higher average power and higher efficiency than that of conventional X-?ray tubes. ...

Еще в разделе: (Показать все результаты (>7) - miles.sinp.msu.ru/ )

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>13) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/nhunt-2.out