THE LABORATORY OF CHEMISTRY AND PHYSICS OF SENSOR AND SEMICONDUCTOR MATERIALS . Head of the Laboratory, Dr.Sci., Prof. Alexander M. Gaskov . ... Development of semiconductor materials for gas sensors . ... Head of the Laboratory of chemistry and physics of sensor and semiconductor materials . ... A. Gaskov, M. Rumyantseva. ... Fe 2 O 3 :SnO 2 Nanostructured System as Semiconductor Gas Sensor Material. ... 2008-2010 The Laboratory of chemistry and physics of sensor and semiconductor materials. ...

Еще в разделе: (Показать все результаты (>22) - www.lssm.inorg.chem.msu.ru/ )

... UHECR SINP MSU . ... TUS . ... mini-EUSO (UV atmosphere) . News . UHECR news . TLE news . Lab's news . Publications . Publications UHECR . ... For students . Our students . ... TUS Ultra high energy cosmic ray detector on-board the Lomonosov satellite . JEM-EUSO Extreme Universe Space Observatory on the Japanese Experiment Module (JEM) of the International Space Station . ... JEM-EUSO is a new type of observatory that uses the earth's atmosphere as a detector. ...

Еще в разделе: (Показать все результаты (>42) - uhecr.sinp.msu.ru/ )

• TLE news
• UHECR news
• High energy electromagnetic cascades in extragalactic space: physics and

... CLEANSOIL . ... Therefore, the system is applicable to the remediation of soil below buildings, roads, pipelines, railroads, etc, for both local and/or diffuse contamination, and even for preventive applications. to develop and to test an innovative, simple, easy to handle, applicable under existing infrastructures and cost-effective on-site and in-situ soil remediation method able to achieve a degree of soil remediation that allows its reutilisation for different purposes; . ... http://soil.msu.ru ...

Еще в разделе: (Показать все результаты (>13) - eco.soil.msu.ru/ )

• Koptsik G.N., et al. Response of pine forests to long-term air pollution at the

... Data . ... The RELEC experiment was specially developed for study of relativistic electrons in near-Earth space together with TLEs in order to test possible connection between these two phenomena. RELEC mission includes x-ray and gamma-ray spectrometer, 3-axis detector for electrons, UV and red-light flash detector, fast optical imager, low-frequency and radio-frequency analyzers of electromagnetic field and waves. ... Electrons 570-850 keV . ... Gamma-rays 50-420 keV + Electrons 0.2-3.15 MeV . ...

Еще в разделе: (Показать все результаты (>66) - smdc.sinp.msu.ru/ )

• Home - Space monitoring data center
• Solar flares - Space monitoring data center
• IGRF10 model - Space monitoring data center

... Antal , T.K., Volgusheva , A.A., Kukarskih , G.P., Krendeleva , T.E., Rubin, A.B. Relationships between H 2 photoproduction and different electron transport pathways in sulfur-deprived Chlamydomonas reinhardtii (2009) International Journal of Hydrogen Energy, 34, pp. ... Antal , T.K., Volgusheva , A.A., Kukarskikh , G.P., Krendeleva , T.E., Tusov , V.B., Rubin, A.B. Examination of chlorophyll fluorescence in sulfur-deprived cells of Chlamydomonas reinhardtii (2006) Biofizika ., 51 (2), pp. ...

Еще в разделе: (Показать все результаты (>6) - biophys.msu.ru/ )

... Студенту и аспиранту . ... Правила проведения зимней экзаменационной сессии на геологическом факультете МГУ . ... Chomat, TPA : .Introduction to Petroleum Geology and Seismics.. 5-day lecture course for Master and PhD students from Petroleum Geology and Geophysics specialities. November, 2011 Lecturer: A. Chaouch, TPA .3D seismic in petroleum exploration.. 5-day lecture course for Master and PhD students from Geophysics and Petroleum Geology specialities. 29-31 марта: проф. НК .Total. ...

Еще в разделе: (Показать все результаты (>8) - geol.msu.ru/ )

... Plants . ... The study of structural and functional plant systems diversity at different levels (cell-to-biocenotic) will reduce the risk of violating the stability of the living systems in Russian Federation. Russian Federation plays a key role in the preservation and use of raw Arctic potential. The highest spore plants, as an essential component of plant communities in northern Holarctic are involved in the settlement of naked substrates, preservation of permafrost and bogging. ...

Еще в разделе: (Показать все результаты (>3) - depository.msu.ru/ )

ChangeLog for / # # Generated by Trac 0.12.5 # 04/11/16 17:24:36 Sun, 19 Dec 2010 22:44:18 GMT Yashina Ksenia ksenia_yashina@тАж [20:2df48c61bd42] * bacteria.py ( added ) * petri.py ( added ) * scale.py ( modified ) now cells can move,reproduce Sun, 19 Dec 2010 22:42:34 GMT Yashina Ksenia ksenia_yashina@тАж [19:b78c555543a8] * vector.py ( added ) added vector module Wed, 15 ...

Еще в разделе: (Показать все результаты (>7) - kodomo.cmm.msu.su/ )

• http://kodomo.cmm.msu.su/trac/petri_dish/log/?format=changelog&rev=21%3Af55481ff4bb5&limit=100&mode=stop_on_copy
• http://kodomo.cmm.msu.su/trac/petri_dish/log/?format=changelog&rev=2df48c61bd4285de81937c0f4a5d378681374ef7&limit=100&mode=stop_on_copy
• http://kodomo.cmm.msu.su/trac/petri_dish/log/?format=changelog&rev=f55481ff4bb5d82106fc33b82cd2d198ad264c3b&limit=100&mode=stop_on_copy

... О проекте . ... A source of medical x-?rays based on a 50 Mev storage ring and a quasi-?continues picosecond laser is considered. It is shown that such generator produces useful X-?ray flux with higher average power and higher efficiency than that of conventional X-?ray tubes. ...

Еще в разделе: (Показать все результаты (>7) - miles.sinp.msu.ru/ )

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>10) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/nhunt-2.out

... Langmuir-Blodgett (LB) technique becomes now an effective tool producing thin molecular films of desired composition and structure. Its development gave rise to numerous experimental investigations of LB films as nonlinear optical wave guides devices. ... It seems to show that effects of LB films structure on their nonlinear optical parameters are mainly connected with specifics of their local field distribution. ...

Еще в разделе: (Показать все результаты (>45) - scon155.phys.msu.su/ )

• Kinetics of domain structure in ferroelectric thin films
• Effect of Coulomb Interactions on the Density of States in Intentionally
• Igor P. Zvyagin

... Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika. ...

Еще в разделе: (Показать все результаты (>33) - vestnik.math.msu.su/ )

Лаборатория химии поверхности . XPS/TEM characterisation of Pt-Au/C cathode electrocatalysts prepared by metal vapour synthesis . Vasil'kov A.Yu , Naumkin A.V. , Volkov I.O., Podshibikhin V.L. , Lisichkin G.V. , Khokhlov A.R. Surface and Interface Analysis , 2010, v.42, ? ... Nenajdenko V.G., Muzalevskiy V.M., Naumkin A.V., Zubavichus Ya.V., Lisichkin G.V. International Conference 'Catalysis in Organic Synthesis'. ...

Еще в разделе: (Показать все результаты (>101) - www.chem.msu.ru/ )

• Семинар "Перспективные наноматериалы"
• CATALYTIC SYSTEMS
• Scientific conference Women in chemistry: biographical portrait, contribution

... If you want to change the appereance, please edit <A HREF="./index.txt">index.txt (template) file</A>. CONVERT=convert -interlace line # IMAGE_FILE = index.txt #TEXT_COLOR=black #IMAGE_TYPE=jpg #VERSION=v. 0.40 #COL_NUMBER=3 #BG_COLOR=silver #SUB_DIR=vecher #EMAIL=havlik@ap.univie.ac.at # HOME =http://www.ap.univie.ac.at/users/havlik/Downloads #TAIL= P H1 A HREF =\ ../$$hr{INDEX}\ TARGET =\ $ TARGETS [0]\ UP /A A HREF =\ $$hr{ HOME }\ TARGET =\ $ TARGETS [0]\ ...

Еще в разделе: (Показать все результаты (>154) - www.pereplet.ru/ )

• Super Ratio

... Программы обучения . ... Пропустить категории курсов . ... Пропустить новости . ... от Администратор ЦДО Ф/Ф МГУ - Понедельник 4 Август 2014, 09:53 . 04 августа 2014 года в Интеллектуальном центре ? ... Российские ВУЗы все чаще переходят на дистанционное обучение . ... ДИСТАНЦИОННЫЕ ПОДГОТОВИТЕЛЬНЫЕ КУРСЫ ФИЗИЧЕСКОГО ФАКУЛЬТЕТА МГУ ПО ФИЗИКЕ И МАТЕМАТИКЕ Пропустить Страницы ЦДО в социальных сетях . ... Центр дистанционного образвания физического факультета МГУ им. М.В. Ломоносова 2007-2012 . ...

Еще в разделе: (Показать все результаты (>2) - distant.phys.msu.ru/ )

... Отделение химиотерапии РОНЦ им.Н.Н.Блохина РАМН, Москва . ... Современные возможности химиотерапии НМРЛ могут быть сформулированы следующим образом: . ... Survival determinants in extensive stage non-small cell lung cancer. ... Non Small Cell Lung Cancer Collaborative Group. Chemotherapy in non small cell lung cancer. ... Lung Cancer, 1997; 18(suppl.2): 67. ... Improved survival in stage III non-small cell lung cancer: Seven-year follow-up of Cancer and Leukemia Group B (CALGB) 8433 trial. ...

Еще в разделе: (Показать все результаты (>324) - www.nature.web.ru/ )

• Микробные ингибиторы ферментов биосинтеза и этерификации холестерина
• Бактериоцины. Образование, свойства, применение
• Джерри П. Беккер, Билл Джейкоб "Математические войны в Калифорнии"

... 939-49-28 . ... Bolotov S.N. deputy head of dpt, docent (lecturer, associated professor) . ... Baraboshkin E.Yu. docent (lecturer, associated professor) . ... Zhuravlev B.Ya. docent (lecturer, associated professor) . ... Kopaevich L.F. docent (lecturer, associated professor) . ... Mileev V.S. docent (lecturer, associated professor) . ... Nazarevich B.P. docent (lecturer, associated professor) . ... Panov D.I. docent (lecturer, associated professor) . ... Veimarn A.B. leading researcher . ...

Еще в разделе: (Показать все результаты (>6) - sbmg.geol.msu.ru/ )

Faculty of Physics of Lomonosov Moscow State University . ... Department of Photonics and Microwave Physics is one of the largest departments of Faculty of Physics of Lomonosov Moscow State University . ... Our department holds annual conference on wave phenomena in nonhomogeneous media, physics and applications of microwaves in May in Moscow suburb. ... Physics of microwaves . ... Department of Photonics and Microwave Physics . Faculty of Physics . Lomonosov Moscow State University . ...

199. Alexander B. Kurzhanski (Kurzhanskiy) | Кафедра системного анализа ВМК МГУ

200. SAI OCL Catalog The Team