... 1998 1 : Defended the Doctorate Degree Thesis on "Models of Cosmic Ray Particle Fluxes (Development and Applications)". ... Space Weather . ... Nymmik R.A., Radiation Environment Induced by Cosmic Ray Particle Fluxes in International Space Station Orbit According to Recent Solar and Galactic Cosmic Ray Models, Adv. ... Nymmik R.A., Radiation Environment Induced by Cosmic Ray Particle Fluxes in International Space Station Orbit According to Recent Solar and Galactic Cosmic Ray Models, Adv.Space Res. ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... Geography of World Economy . ... Departments . About Faculty . ... Field stations . ... Type of field courses . ... Department of Geography of World Economy . Department of Landscape Geochemistry and Soil Geography . ... Department of Oceanology . ... Department of Social-Economic Geography of Foreign Countries . ... In particular, the Dean of the Faculty and the Heads of Departments have a direct responsibility for the efficient running of academic departments. ... DEPUTY DEAN FOR RESEARCH . ...
Tentative academic program of Summer School in Coastal Ecology and Biological Safety (June 14-26, 2010; White Sea Biological Station) Version of January 27, 2010 Module I (4 days ): Invertebrates' Diversity of Coastal Zone Lectures + seminars, boat and short hiking excursions, laboratory work , individual work a) Main groups of invertebrates: the resident and endemic species of the W hite Sea b) Gathering and ...
... Nonlinear fiber optics . ... member of the Editorial Board for the Laser Physics journal . ... Member of the steering committee of the international conference on Raman spectroscopy (ICORS): Budapest, 2002; Brisbane, 2004; Yokohama, 2006; London, 2008 . Member of the steering committee of the International Laser Physics workshop: Bratislava, 2002; Hamburg, 2003; Trieste, 2004; Kyoto, 2005; Lausanne, 2006; Leon, 2007; Trondheim, 2008; Barcelona, 2009 . ... International conference ?Laser Optics? ...
... The detectors used in the setup had efficiency three orders of magnitude better than ones used before. ... As a result, effect of nonlocal influences of several largescale processes related with the weather changes, the geomagnetic variations, the ionospheric and solar activity have reliable been detected. ... йи з ед гв б 7 (2) (3) (4) All known local factors influencing on : temperature, pressure, chemism, illumination, electric field etc. must be excluded or stabilised. ...
[
Текст
]
Ссылки http://temporology.bio.msu.ru/EREPORTS/korotaev_experimental.pdf -- 224.4 Кб -- 27.02.2014 Похожие документы
... Кафедра системного анализа ВМК МГУ . ... О кафедре . ... на кафедру . ... ВМК . МГУ . ... СМУ ВМК . ... Alexandr Borisovich Kurzhanski) . In Russian . ... Kurzhanski was Elected Associate Member of USSR Academy of Sciences (now changed to Russian Academy of Sciences) in 1981 and Full Member in 1990. He is the Chairman of the Russian National Committee on Automatic Control (the IFAC NMO). ... Chairman of Russian National Committee of Automatic Control. ... 4 (8). pp. 100-118. (in russian). ...
Human longevity at the cost of reproductive success: evidence from global data ц б F . ... Abstract A trade-off between reproduction and somatic maintenance and hence survival is fundamental to life-history theory. We investigated the relationship between female fecundity and longevity in Homo sapiens using data from 153 countries located all over the world. The raw correlation between life span and fecundity was highly signi®cant with a negative trend. ... 1998; Polis et al., ...
[
Текст
]
Ссылки http://ecology.genebee.msu.ru/3_SOTR/CV_Terekhin_publ/2000_Longev_JEvolBio.pdf -- 97.8 Кб -- 16.03.2009 Похожие документы
... Ph.D. (Doctor of physico-mathematical sciences), Professor . ... Ph.D. (Candidate of physico-mathematical sciences), Associate Professor . ... Scientific secretary of the ASR Department, Ph.D. (Candidate of physico-mathematical sciences), Associate Professor . ... Ph.D. (Candidate of physico-mathematical sciences), senior researcher . ... Ph.D. (Candidate of physico-mathematical sciences), research fellow . ... Source URL: http://ani.cs.msu.su/en/staff . ...
О лаборатории . ... Лаборатория теоретической биофизики . ... For lipid bilayer modelling the whole toolchain was built: from creating membranes to MD trajectory analysis. ... We use OPLS-AA with some includings; ?includings? are overlays on the standart GROMACS forcefield files. ... 4 комментариев " Lipid membrane MD modeling with GROMACS " . Python membrane generator for MD simulations ERG Research Group: Лаборатория теоретической биофизики написал (Февраль 14th, 2012 4:11 пп) . ...
... Department of History of Foreign Literatures, Lomonosov State University of Moscow (MGU) . About the department . ... Department history . ... About the department / Lectors . ... Chairman, Ph.D., Professor . ... Ph.D. , Associate-Professorљ . ... Ph.D. , Professor . Aleksandra Yuryevna Zinovyeva . ... Ph.D. ,љSenior Researcher . ... Ph.D. , Researcher . ... Ph.D. , Assistant-Professor . ... Olga Yuryevna Panova . ... Irina Yuryevna Popova . ...
... Leading Research Associate (MSU) . ... Graduated from the Moscow State University, 1960 . PhD, Moscow State University, 1970 . Doctor of Sciences, Moscow State University, 1995 . ... Type of Research: experiment . Research Interests: . ... Graduated from the Moscow Institute of Chemical Technology, 1954 . PhD, Moscow Institute of Chemical Technology, 1958 . Doctor of Sciences, Moscow Institute of Chemical Technology, 1981 . ... Type of Research: experiment, theory . ...
Tools for monitoring of data exchange in real-time avionics systems V.V. Balashov, V.A. Balakhanov, A.G. Bakhmurov, M.V. Chistolinov, P.E. Shestov, R.L. Smeliansky, N.V. Youshchenko Lomonosov Moscow State University, Dept. of Computational Mathematics and Cybernetics, Laboratory of Computer Systems e-mail: {hbd,baldis,bahmurov,mike,osmin,smel,yoush}@lvk.cs.msu.su Abstract In this paper we present a toolset for monitoring of data exchange through onboard channels of real-time avionics (RTA) systems. ...
[
Текст
]
Ссылки http://lvk.cs.msu.su/~bahmurov/course_realtime/papers/balashov_et_al_eucass2011_monitoring.doc -- 194.5 Кб -- 27.05.2015 Похожие документы
Психология имеет долгое прошлое, но довольно короткую историю" (Г. Эббингауз, 1908) . Статьи и ссылки по истории психологии. Конференции 2000 года. ... Millennium World Conference in Critical Psychology, Sidney, Australia . XXVII Congress of Psychology 2000, Stockholm, Sweden . ... CSS 2000, the annual online conference for the Association for Computers and the Social Sciences . ... CiP2000, Computers in Psychology Conference , 29th March - 31st March 2000, University of York, UK. ...
... Study of the Russian " Silver Age " neology . ... Dictionaries of neologisms constitute an important part of lexicography. ... The peculiarity of our project is the full scope of text (at least published) considered and uniformity of description: dictionary entries of all the authors’ neologisms have the same format (suggested for Khlebnikov’s neology). ... Khlebnikov's neology (N. N. Pertsova). In 1995 "The Dictionary of Khlebnikov's Neologisms" was published. ...
... Printed in U.S.A. COMPLEX FORMATION HISTORY OF THE LENTICULAR GALAXIES WITH STELLAR COUNTERROTATION: NGC 4138 AND NGC 45501 V. L. Afanasiev Special Astrophysical Observatory, Nizhnij Arkhyz, 369167 Russia; vafan@sao.ru and O. K. Sil`chenko 2 Sternberg ... To further explore this idea, we undertook a special study of stellar population properties in the centers of two early-type disk galaxies with counterrotating global stellar disks: NGC 4138 and NGC 4550. ... NGC 4138 3.1. ... NGC 4550 4.1....
... Opportunities for Research Section Financial and Legal Mechanisms for Developing Russia in the Context of Global Political and Economic Instability Chairperson: Professor Alla Bobylyova Head, Department of Financial Management, School of Public Administration Lomonosov Moscow State University Secretary: Olga Lvova Department of Russian History, School of Public Administration Lomonosov Moscow ...
[
Текст
]
Ссылки http://www.spa.msu.ru/uploads/files/konferenzii/_program_conference_2013_eng.pdf -- 326.1 Кб -- 21.05.2013 Похожие документы
... A member of the Russian Academy ofsciences, a great physicochemist,and a world-renowned Professor Boris Vladimirovich Derjaguin died on May scientist, he laid the foundation of the modern science of colloids and surfaces. ... B. V. Derjaguin became known world-wide in scientific circles for his work on the stability of colloids and thin films of liquids which is now known as the DLVO theory, after the initials of its authors: Derjaguin, Landau, Verwey, and Overbeek. ...
Euro-Asian Astronomical Society . The International Astronomy Olympiad . ... On the basis of the present Founding Statutes the Coordinating Council of the International Astronomy Olympiad elaborated and if necessary replenishes the "Acting Statutes/Regulations on International Astronomy Olympiad of School Children" which are approved at the meeting of authorized representatives from the founding organizations and participating states held every year during the Olympic period . ...