... Ph.D. in Physics and Mathematics (Theoretical and Computational Chemistry), Department of Chemistry, M.V.Lomonosov Moscow State University . M. Sc. in Chemistry, Department of Chemistry, M. V. Lomonosov Moscow State University (2000), Thesis: "Ab initio study of equilibrium structures and vibrational spectra of molecular clusters". ... Undergraduate Student, Department of Chemistry, M. V. Lomonosov Moscow State University (1995-2000). ... Quantum and Computational Chemistry; . ... autumn 2001. ...
... Hotel Information . Through the intermediary of the Moscow Academservice DMC Company , hotel accommodation can be reserved at reduced rates in the hotels below: . Hotel name . ... Arbat . ... Hotel "MIR" . ... To reach the University by metro from the hotel "Mir", walk to the metro station "Krasnopresnenskaya" (brown line, see Moscow Metro map ), go to "Park Kultury" (two stops), change the line to the red one and go down to the "Universitet" metro station (three stops). ... Hotel "ARBAT" . ...
Lomonosov Moscow State University FACULTY OF ARTS 2011 ALEXANDER LOBODANOV DEAN OF THE FACULTY OF ARTS WxtЊ vҐЂЂxtzтxс4 g{x YtvтЂрч Ґy TЊрс уxЊx tvvx¶рxw |° ... Since 2003 he has been chairman of the Department of Semiotics and the General Theory of History, founded by him, the first of its kind in Europe. ... Department of Semiotics and the General Theory of Arts The Department of Semiotics and the General Theory of Arts is a theoretical department. ... Galina Zadneprovskaya manages this department. ...
Department of Physics, Lomonosov Moscow State University . Laboratory "Сryoelectronics" . Laboratory of Cryoelectronics (LCE) was established in the beginning of 1988 on the base of scientific group of Prof. Konstantin K. Likharev originated in 70-th at Physics Department of Moscow State University. ... As it was circumstantially formed, two organizations equipped our laboratory: the Physical Department of MSU and the section of Microelectronics of SIMP (NIIYaF) MSU. ...
Ionization Dynamics of Atoms Exposed to Strong Laser Pulses: SemiAnalytical Model at Low Field Frequencies Yu.V. Popov Skobeltsyn Institute of Nuclear Physics, Lomonosov Moscow State University Collaboration B. Piraux, A. Hamido. ... INTRODUCTION AND MOTIVATIONS Keldysh has introduced the adiabaticity parameter = (2Ip)1/2/E where is the laser field frequency, E, the field amplitude, and Ip the ionization potential of the atom. ... Both of them, multiphoton processes and tunnel ionization play a role. ...
... Кафедра системного анализа ВМК МГУ . ... О кафедре . ... на кафедру . ... ВМК . МГУ . ... СМУ ВМК . ... Alexandr Borisovich Kurzhanski) . In Russian . ... Kurzhanski was Elected Associate Member of USSR Academy of Sciences (now changed to Russian Academy of Sciences) in 1981 and Full Member in 1990. He is the Chairman of the Russian National Committee on Automatic Control (the IFAC NMO). ... Chairman of Russian National Committee of Automatic Control. ... 4 (8). pp. 100-118. (in russian). ...
... E-mail: Tchytannya@gmail.com Website of the Conference: www.tchytannya.org.ua Mailing address: National University "Law Academy of Ukraine named after Yaroslav Mudriy", Department of the Constitutional Law of Ukraine, organizing committee of The International Science Conference of Young Scientists, Researchers, Postgraduates and Students "Values of modern constitutionalism (V Todyka's readings)" Pushkinska street, 77, Kharkiv, 61024, Ukraine. ...
[
Текст
]
Ссылки http://www.law.msu.ru/bitcache/9af64c1c38133e2400976ad6af22fd1007e46b3e?vid=21924&disposition=attachment&op=download -- 283.0 Кб -- 01.10.2012 Похожие документы
S .. ... a database of structures of DNA-protein and RNA-protein complexes. ... a program for finding hydrophobic clusters in 3D structures of macromolecules . ... search of conserved hydrophobic clusters in aligned 3D structures of protein families . ... a program for analysis of multiple alignments . ... a program for automatic detection of aligned blocks in a multiple protein alignment. ... a program for detection of aligned blocks in a multiple alignment of sequences of PDB chains. ...
... Труды ЗБС . ... Новости . 2014 . ... Программа лекций на практике на ЗБС МГУ, лето 2014. ... Звенигородская биологическая станция ? ... Звенигородская биологическая станция имени С.Н. Скадовского Биологического факультета Московского государственного университета имени М.В. Ломоносова является учебно-научным центром междисциплинарных фундаментальных и прикладных исследований, . ... 12, МГУ, Биологический ф-т., . ... 2016 Звенигородская биологическая станция имени С.Н.Скадовского . ...
PC GAMESS/Firefly TIME DEPENDENT DENSITY FUNCTIONAL THEORY MODULE $TDDFT group required when CITYP=TDDFT (note that CITYP=TDDFT requires DFTTYP to be set in $CONTRL) Current implementation allows the use of only R-DFT references, but can pick up both singlet and triplet excited states. ... The default for n is the number of chemical core orbitals. ... ALTER - flag to modify internal logic of Davidson diagonalization code to use dynamic number of trial vectors. ... PC GAMESS/Firefly' NBO code . ...
... Положение об олимпиаде . Регламент олимпиады . ... Отборочный этап . ... Пройти отборочный этап . Результаты . Победители и призеры прошлого года . Заключительный этап . График заключительного этапа . ... Календарь отборочного этапа . ... Календарь заключительного этапа . ... Заключительный этап для 5-9 классов . ... Олимпиадные работы победителей и призеров заключительного этапа . Дипломы победителей и призеров заключительного этапа . ... Архив заданий 2015 года . ...
... Astronomy search engine . ... PhysicsWeb Home Page . ... Sternberg Astronomical Institute . ... Astro Space Center Home Page . ... Landau Institute for Theoretical Physics . ... Astronomy and Space Physics Dept of Kiev University . ... NATIONAL RADIO ASTRONOMY OBSERVATORY Home Page . University of Hawaii - Institute for Astronomy . ... Space Telescope Science Institute Home Page . ... Sky & Telescope: The Essential Magazine of Astronomy . ... Springer LINK - Physics Online Library . ... Home . ...
... Graduated from M.Lomonosov Moscow State University, Department of Mechanics and Mathematics. Dissertation's title of Ph.D. (Phys.& Math): "Aerodynamic Characteristics, Shape-Formation and Stressed-Strained State of Parachute Canopy." ... Graduated from M.Lomonosov Moscow State University, Piano Class. ... Development of mathematical models and parameter computation methods for the shape, aerodynamic drag and stressed-strained state of parachutes with different canopy geometry. ...
... Graduated in 1963 from the Faculty of Mechanics and Mathematics (Moscow State University). ... Honorary Doctor of Tokai University (Japan), Honorary Doctor of Istanbul University (Turkey), Honorary Doctor of Mongolian University , Honorary Doctor of Hanoi National University (Viet-Nam), Honorary Doctor of Byelorussian State University , Honorary Doctor of Yerevan University (Armenia), Honorary Doctor of Tashkent University (Uzbekistan), Honorary ...
... Seminar archive . ... The structure of the X-ray sources in the hard spectral state of accreting black-hole binaries has been a subject of intense debate. The paradigm dominant for many years postulated that the accretion disc in the hard state is truncated at some radius >> the innermost stable orbit (ISCO) whereas the disc reaches the ISCO in the soft state. ... On the other hand, there have been numerous claims in recent years that the disc extends to the ISCO in the hard state. ...
... If you have already registered, please fill in you login and password in the form below main menu (leftmost column). ... If something goes wrong (for example, you've been registered by site andministrator and don't have password at all or you just forgot it), please contact site administration by E-mail dubna2007@biophys.msu.ru . ... If you are warned that you've already registered please contact site administration by E-mail dubna2007@biophys.msu.ru to get access to your Personal Office . ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
Главная Международные связи Иностранным студентам/ Incoming students . ... Semester Dates for International Students: . ... In case of institutional agreement on international student exchange the program is free of charge. ... All students should come to Russia by Moscow State University invitation. ... Students enter Russia with a single-entry visa. ... Exams/Passes . ... Pass . ...