Triple I – Integration, Interaction and Institutions Call for Applications Application deadline 22 April 2009 for mobilities starting during spring 2010 at the latest. Triple I awards scholarships for studies and research in 19 European and Russian partner universities. ... Triple I awards scholarships within the theme of Integration, Interaction and Institutions. ... All applications are expected by 22 April 2009, 14:00 Finnish time (GMT +2) at the latest. ...
Studying at MU Programs and degrees . ... Moscow State University provides a wide range educational services and educational programmes. ... International students are offered Bachelour (4 years full time) and Master programmes (2 years full time). A number of our faculties train both domestic and international students according to Bachelour and Master programmes with granting Bachelour and Master diplomas. ... Please, contact International Students Office for information on the topics offered. ...
... Attention Eurasian Undergraduate Students. IREX is pleased to announce the 2003 FREEDOM Support Act Undergraduate Program (FSAU). The deadline for this application is October 31, 2002. The program provides opportunities to first-, second-, and third-year undergraduate students from Armenia, Azerbaijan, Belarus, Georgia, Kazakhstan, Kyrgyzstan, Moldova, Russia , Tajikistan, Turkmenistan, Ukraine, and Uzbekistan for non-degree study in the United States for one academic year. ...
... 2 (1997) 147-157 PRINCIPAL TRENDS IN MODERN ECOLOGY AND ITS MATHEMATICAL TOOLS: AN ANALYSIS OF PUBLICATIONS* E. V. BUDILOVA, J. A. DROGALINA, A. T. TERIOK.HIN Department of Biology, Moscow State University, Moscow 119899 (Russia) E-mail: lenl@ATeriokhin.home.bio.msu.ru (Received March 12, 1997) The paper deals with a scientometric analysis of publications from the journals Ecology and Ecologia (Russia) based on the ... Keywords of group С are encountered in 17% and В in 11% of papers. ...
[
Текст
]
Ссылки http://ecology.genebee.msu.ru/3_SOTR/CV_Terekhin_publ/1997_Scientometrics.doc -- 332.0 Кб -- 16.03.2009 Похожие документы
... Исследователи химического факультета МГУ представили проект моделирования молекулярной динамики опасных вирусов . ... Владимир Пентковский, известный разработчик программно-аппаратных архитектур, заслуженный исследователь Intel, обладает большим опытом создания научных коллективов в России, США и Индии. ... 2003 2011 MsuNews.Ru Новости МГУ . ... Экспорт новостей (RSS) ...
МГУ имени М.В.Ломоносова Русская версия . ... Public and Municipal Administration . ... Public Relations and Theory of Communication . ... The section "Public Relations and Theory of Communication" based on an educational program "Advertisement and public relations" of Philosophical Faculty of MSU. The research supervisor of an educational program the head of "Philosophy of Language and Communication" department Kostikova A.A., the associate professor , candidate of philosophical sciences. ...
Лекции Dr. Sheldon Landsberger, профессор университета Техаса USA. Дубна, 14.04.2014 . Информируем Вас и приглашаем посетить лекции Dr. Sheldon Landsberger, . Professor in the Nuclear and Radiation Engineering Program in the Mechanical Engineering Department at the University of Texas at Austin, USA . ... Applications in Environmental Analysis Лекции будут проходить в конференц-зале ЛНФ в следующие дни: . ... Аннотация в приложении: hep.msu.dubna.ru/main/file.php/74/Landsberger.zip . ...
Lomonosov Moscow State University , Skobeltsyn Institute of Nuclear Physics . ... Links . ... CDFE => Links . ... Space Physics Online Data Services at MSU SINP . Japan Atomic Energy Research Institute Nuclear Data Center . Korean Atomic Energy Research Institute Nuclear Data Center . MacNuclide Nuclear Data Base Management System . ... Radiation Safety Information Computational Center , Oak Ridge National Laboratory . ... Los Alamos National Laboratory Nuclear Data Viewer . ...
Call for Papers September 26-30, 2016 National Cultural Center "Minsk", Minsk, Belar us ICONO/LAT 2016 Int' l Conference on Coherent and Nonlinear Optics (ICONO 2016) Int' l Conference on Laser s, Applications, and Technologies (LAT 2016) The leading event in the area of quantum electronics, laser physics, photonics and their applications. ... Russia Vladimir Belyi, Stepanov Inst. of Physics, NASB, Belar us ICONO Program Vice-Chairs Yulia Vladimirova, Lomonosov Moscow State Univ., ...
[
Текст
]
Ссылки http://iconolat16.phys.msu.ru/download/icono-lat-2016-fcp-reduced.pdf -- 656.9 Кб -- 29.01.2016 Похожие документы
... ICONO Invited Speakers . ... Gennadiy Kulipanov, Budker Inst. of Nuclear Physics, Russia . ... Marlan Scully, Texas A&M Univ., ... Andrey Goncharov, Inst. of Laser Physics, Russia . ... Vladimir Trunov, Inst. of Laser Physics, Russia . ... Since 1987, he has worked at the National Research Council of Canada (Ottawa) in the field of laser physics and trapped ion optical frequency standards. ... Alexey Taichenachev , Inst. of Laser Physics, Russia . ... S. Vatnik, Inst. of Laser Physics, Russia . ...
Please enter the lightcurve file name and period search parameters: . Lightcurve file: . ... Apply the Heliocentric correction and convert all dates to Terrestrial Time (TT)? ... Phase range for plots: -0.5 to 1.0 0.0 to 2.0 0.0 to 1.0 . ... Also, the Heliocentric correction cannot be applied to such lightcurves. ... Two period search methods are currently implemented. ... This period search service is also available at the mirror sites: Mirror 1 , Mirror 2 , Mirror 3 , Mirror 4 . ...
... Данный раздел информационного портала посвящен основным конференциям по тематике ПЛИС, проходящим как в мире, так и в России. FPGA 2010 - Eighteenth ACM/SIGDA International Symposium on Field-Programmable Gate Arrays. ReConFig'09 - 2009 International Conference on ReConFigurable Computing and FPGAs. ИКТМР-2009 . ... 2009 Symposium on Application Accelerators in High-Performance Computing (SAAHPC'09) . RAW 2009 . ... 5th International Workshop on Applied Reconfigurable Computing. ...
hpc@cmc . Высокопроизводительные вычисления на ВМК МГУ . Blue Gene/P . Regatta . ... Серия Blue Gene в мире . ... Факультет вычислительной математики и кибернетики МГУ . ... parallel.ru . ... Parallel Computing . ... Некоммерческое программное обеспечение Intel : . ... Часть ссылок и описаний к ним любезно предоставлена администратором сайта кафедры АНИ факультета ВМК МГУ имени М. В. Ломоносова . Факультет ВМК МГУ . ... 2008 2013 Факультет ВМК МГУ имени М. В. Ломоносова . ...
... 8 February , 2014 SAI seminar (Ryde et al 2010) 5 Thermal emission from GRB jet progenitor observer photon jet Photosphere (=1) · · · · Photons are not produced at the photosphere We have to calculate radiative transfer We need to know where the photons are produced We construct the expression for effective optical depth in relativistic flow considering random walk process in relativistic flow SAI seminar 6 8 ... 8 February, 2014 SAI seminar 28 ...
[
Текст
]
Ссылки http://master.sai.msu.ru/media/presentations/2014/20140208_Shibata.pdf -- 1131.7 Кб -- 07.02.2014 Похожие документы
Given word length and max number of mismatches . Use MEME algorithm for define conserved blocks . Apply the Dynamic programming algorithm to create chain of the blocks . Refine the chain using combined profile for chain of blocks. ... Reduce word length and number of mismatches and repeat the procedure for spacer between the blocks. ... Create helix profile and apply MEME-like iterative procedure to find sets of helices that consistent lokated reative to conserved blocks . ...
... Кафедры . ... Практика . Производственная практика 2015 . ... IS PLEASED TO WELCOME INTERNATIONAL STUDENTS TO . ... International students enjoy both a regular curriculum and an in-depth study of the Russian Language, Russian Culture and History of Russia. ... a certified Russian translation ofљ both the original of Secondary School Certificate (or equivalent) and its attachment. ... a certified copy of ID/passport (the original of ID/passport is to be produced on application) . ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... Society . ... Viktor Titovich Trofimov , professor, Department Chairman at the Faculty of Geology, Vice President of the Lomonosov Moscow State University . ... Ksenia Vsevolodovna Avilova , Candidate of Biological Sciences, senior research associate of the Faculty of Biology at the MSU . Aleksandr Sergeevich Alekseev , Doctor of Geological Mineralogical Sciences, professor at the Faculty of Geology at the MSU . ... 2015 Moscow Society of Naturalists . ...