Ричард Столлмен (Richard Matthew Stallman) (р.1953) основатель проекта GNU ("GNU Is Not Unix", 1984 г.), основатель Фонда Свободного ПО (Free Software Foundation, 1985 г.), лауреат премии МакАртура (1990 г.), премии ACM Grace Murray Hopper's Award (1991 г.). ... freedom 0: use software for any purpose . freedom 1: study software (sources required) . ... Линус Торвальдс (Linus Benedict Torvalds) (р. 1969 г.) автор ядра Linux (1991 г.), на котором основана свободная операционная система GNU/Linux. ...
... Head of Analytical Chemistry Division, Department of Chemistry, Lomonosov Moscow State University. Principal researcher, Kurnakov Institute of General and Inorganic Chemistry, RAS. ... 1950-1955 - student of Department of Chemistry, Lomonosov Moscow State University. ... Since 1978 - professor of Analytical Chemistry Division, Department of Chemistry, Lomonosov Moscow State University; since 1989 - head of the Division (half time). ... USSR State Prize (1972) . ... Moscow State University . ...
... Добавить новое сообщение . ... Геном бананов будет секвенирован . ... Представители частного фонда Samuel Roberts Noble Foundation и университета Оклахомы объявили о начале реализации новых планов по определению генетической последовательности бобового растения. ... Люцерна является одним из важнейших источников корма для животных, и ее геном может сослужить хорошую службу для усовершенствования других видов бобовых растений. ... Samuel Roberts Noble Foundation: http://www.noble.org . ...
Journal of Magnetism and Magnetic Materials 383 (2015) 110 113 Contents lists available at ScienceDirect Journal of Magnetism and Magnetic Materials journal h ome p age : www. e ls evier.c o m/locate/jmmm Transverse magneto-optical Kerr effect in 2D gold garnet nanogratings A.V . Chetvertukhin a, A.I. Musorin a, T.V. Dolgova a, H. Uchida b, M. Inoue c, ... Large Q-factor of the resonance is attributed to the localisation of optical fields in the magnetic garnet film. ...
... Laboratory sample measurements are long used worldwide for this purpose. ... The samples were taken from non-polluted site and the pollutants were added in them in the laboratory. ... Further on the degree of saturation was kept up by adding water to the samples daily. ... The chargeability difference between non-polluted sample and other samples increases rapidly during the first week and then the rate of change grows less becoming almost negligible in the end of the measurement time span. ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
. Information by your request is not available. This is ejudge contest administration system, version 3.5.1+ (GIT 2eb5ef0), compiled 2016-03-20 11:30:56. This program is copyright 2000-2016 Alexander Chernov. This program is free software; you can redistribute it and/or modify it under the terms of the GNU General Public License as published by the Free Software Foundation ; either version 2 of the License, or (at your option) any later version. Visual design and web-interface 2006-2016 Toto Lasvik .
... J.-B. Lully: Cadmus et Hermione - Acte III . ... Acte II . ... ACTE III Le Th tre change et repr ente un d sert et une grotte. ... Les deux Princes tiriens, Arbas, deux Afriquains. Два тирских князя, Арбас, два африканца. ... As tu peur du dragon de Mars ? ... Страшен Марса тебе дракон? ... Que l'on doit iuger du courage ? ... Cadmus veut essayer de rendre Mars propice, . ... Cadmus, Arbas. ... Arbas se cache et Cadmus combat contre le dragon. ... On ne satisfait Mars que par de grands exploits. ...
... Положение об олимпиаде . ... Отборочный этап . ... от Оргкомитет олимпиады школьников "Ломоносов" - Четверг, 25 Февраль 2016, 12:10 . ... от Оргкомитет олимпиады школьников "Ломоносов" - Среда, 3 Февраль 2016, 18:52 . ... от Оргкомитет олимпиады школьников "Ломоносов" - Понедельник, 1 Февраль 2016, 17:12 . ... Оргкомитет олимпиады школьников ?Ломоносов? приглашает вас к сотрудничеству с целью организации и проведения заключительного этапа Олимпиады на вашей базе по различным профилям. ...
... Department of Mathematics, . Faculty of Physics, MSU . ... Mathematical analysis 2 . ... Department seminar . ... Vladimir Andreev , Moscow State University, Russia . ... Vera Beloshapko , Moscow State University, Russia . Alexander Belov , Moscow State University, Russia . Inna Belukhina , Moscow State University, Russia . Igor Blatov , Povolzhsky State University of Telecommunications and Informatics, Russia . ... Department of Mathematics, Faculty of Physics, Lomonosov MSU 2014-2016 ...
... Кафедра системного анализа ВМК МГУ . ... О кафедре . ... на кафедру . ... ВМК . МГУ . ... СМУ ВМК . ... Alexandr Borisovich Kurzhanski) . In Russian . ... Kurzhanski was Elected Associate Member of USSR Academy of Sciences (now changed to Russian Academy of Sciences) in 1981 and Full Member in 1990. He is the Chairman of the Russian National Committee on Automatic Control (the IFAC NMO). ... Chairman of Russian National Committee of Automatic Control. ... 4 (8). pp. 100-118. (in russian). ...
... О МЛЦ МГУ . ... Главная Cотрудничество ILC of Bratislava ILCB laboratories Library and Information Center . Development of the data bases, preparation of the multimedia presentations and publications in the fields of photonics and laser technologies, organization of training courses and distant learning. The laboratory aims at preparing publications, multimedia and internet presentations, developing multimedia and internet training courses, and publishing handbooks. ... 2008 МЛЦ МГУ . ...
First announcement VII Moscow International Conference on Operations Research (ORM2013) Moscow, October 15-19, 2013 Dear colleagues, we invite you to attend the VII Moscow International Conference on Operations Research. ... Dorodnicyn Computing Center of RAS (CC of RAS), Lomonosov Moscow State University (MSU) and Russian Scientific Operations Research Society (RSORS) will organize the VII Conference in October 2013 in Moscow. Working language of the conference is English. ...
[
Текст
]
Ссылки http://io.cs.msu.ru/ORM2013/ORM2013-first_announ-ENG.pdf -- 225.3 Кб -- 15.10.2012
[
Текст
]
Ссылки http://io.cs.msu.su/ORM2013/ORM2013-first_announ-ENG.pdf -- 225.3 Кб -- 15.10.2012
[
Текст
]
Ссылки http://io.cmc.msu.ru/ORM2013/ORM2013-first_announ-ENG.pdf -- 225.3 Кб -- 15.10.2012 Похожие документы
... Home . ... About the project . ... Financing . Main grant . ... Scientific results . ... In late 2014 the Moscow State University signed an agreement # 14-50-00029 with the Russian Science Foundation to perform scientific works on the theme "Scientific basis for the creation of the National depositary bank of living systems". Financing: total 750 million rubles, including: 300 million rubles in 2015 and 150 million rubles per 2016-2018 years. ...
... 16 апреля состоится очный тур универсиады Ломоносов по государственному управлению . ... Лекция-встреча с профессором Полом Чейсти 31 марта факультет государственного управления МГУ имени М.В. Ломоносова провел открытую лекцию-встречу с профессором Полом Чейсти (Великобритания) на тему 'Президенты и парламенты в современном мире: сравнительный анализ (государства Африки, Латинской Америки и постсоветского пространства)'. ... Вышел в свет 54-й выпуск журнала 'Государственное управление. ...
... 2 1 2 (2008) 59 available at www.sciencedirect.com journal homepage: www.elsevier.com/locate/ecolmodel The impact of different density stresses on the dynamics of two competitive populations Anatoly T. Teriokhin , Elena V. Budilova Department of Biology, Moscow Lomonosov State University, Moscow 119992, Russia article Article history: info abstract We compare the asymptotic dynamics of two competitive populations described by a ... Second, only the density of youngs can be reduced. ...
[
Текст
]
Ссылки http://ecology.genebee.msu.ru/3_SOTR/CV_Terekhin_publ/2008_R0r_EcolMod.pdf -- 382.8 Кб -- 16.03.2009 Похожие документы
Conference . ... 3rd Announcement . 2nd Announcement . ... The 2006 autumn IVOA Interoperability Meeting and Small Project Meeting will be held in Moscow, Russia, from September 18-22. The venue for the meeting are Institute of Astronomy, Sternberg Astronomical Institute and Headquarter of the Russian Academy of Sciences. ... Working Groups: VOTable, UCDs, Registry, Data Models, Data Access Layer, VO Query Language, Grid and Web Services, and VOEvent. Interest Groups: Applications, Theory. ...
Home People Activities Research Publications . Yurin's home page . ... Юрин Д.В. "Расчетно-параметрическое исследование флуктуаций сигнала обратного рассеяния при лазерном зондировании взволнованного моря " // Автореферат диссертации на соискание ученой степени кандидата физико-математических наук (специальность 01.04.03-радиофизика). ... Юрин Д.В. "Метод расчета статистических характеристик сигнала обратного рассеяния при лазерном зондировании взволнованного моря " // В кн. ...
MSU . Science Park . ... Companies . ... General Director of Moscow State University Science Park . In your opinion, how effective is the Triple Helix within the Russian science park environment? ... MSU Science Park is a university based science, one of the leading in Russia. ... On the one hand, decisions on developing and approving innovation development programs, that became publicly available, had accepted in companies with the state participation at the level of boards of directors. ...