... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
Technical aspects of the search for anomalous Wtb couplings. ... Outline What we call anomalous Wtb couplings Operators and vertex approaches Anomalous couplings in production cross section Anomalous couplings in the decay of top quark Effective operators in the field theory: In the units where = c = 1, the fields of the SM have mass dimensions: scalar: vector: fermion: Every term ... Problems of vertex function approach: We use operators with different mass dimensions. ...
[
Текст
]
Ссылки http://qfthep.sinp.msu.ru/talks2011/anomalous_wtb_qfthep11.pdf -- 2411.7 Кб -- 05.10.2011 Похожие документы
... Scientific Effort . ... Cosmic ray astrophysics . Space Physics . ... Nuclear physics . ... The paper was prepared with contributions from Elena Popova from the Skobeltsyn Institute of Nuclear Physics (Lomonosov Moscow State University) and was published in Scientific Reports. ... Federal State Budget Educational Institution of Higher Education M.V.Lomonosov Moscow State University, Skobeltsyn Institute of Nuclear Physics (SINP MSU), 1(2), Leninskie gory, GSP-1, Moscow 119991, Russian Federation . ...
Home . Database of structures of nucleic acid - protein complexes . ... List of complexes . Pfam families . SCOP families . Interaction classes . ... NPIDB . ... Information on SCOP and Pfam domains detected in protein chains is presented. ... Each family has its own web page with the list of entries that include domains of the family. ... List of SCOP domains occurred in DNA-protein and RNA-protein complexes is organized in tree-like form, according to the SCOP classification. ...
Программные средства построения интернет-атласов . ... В работе описывается разрабатываемая в НИВЦ МГУ технология и поддерживающие ее программные средства комплексного отображения разнородной пространственно распределенной информации, в том числе в среде Интернет. ... Описываемая технология состоит в подготовке на инструментальной машине файлов (HTML-страниц, файлов с программами управления данными и их визуальным представлением и файлов данных), представляющих собой Интернет публикацию. ...
Создание и оценка цифровых моделей рельефа высокой точности для урбанизированных территорий на основе цифровой картограф. продукции. Creating and evaluating high resolution DEM's for an urban environment from digital cartographic products / Carter J. R., Tripathy D. // 21 International Cartographic Conference "Cartographic Renaissance", Durban , 10-16 Aug., 2003. ... Durban, 2003, 10-16 Aug., ... С. 1851-1858. ...
... О проекте . ... The possibility of the creation and the application prospects of the laser-electron X-ray generator based on Thompson scattering of laser radiation on a bunch of relativistic electrons are considered. ... The layout of beam-lines and experimental stations intended for the applications of the X-ray laser-electron generator to the investigation of the elemental composition, material structure and biological objects is discussed. ...
Серверные функции OS/2 . ... Если вы еще не вошли (не зарегистрировались) в системе, то надо запустить "Peer Workstation Logon" и в появившемся окне набрать свое имя (User ID) и пароль (Password). Находим и запускаем "Sharing and Connecting" . ... Например, выберем директорию UTIL на диске D: . ... Определим доступ к вашему ресурсу, нажмите кнопку "Grand access". ... Read only - только чтение . ... В окне "Sharing and Connecting" появится общий ресурс, при необходимости можно создать еще. ...
... Place: A private EE centre (Laboratory for Optimization of Nature Exploitation LONE) and public kindergartens at Pushchino in the Moscow region. Target groups: Pre-school age children (3-6), school children (9-15), kindergarten teachers. ... In the second phase training was provided to all kindergarten teachers who volunteered to participate in the project as well as for 20 school children selected during practical courses, lectures and seminars. ...
... Carbamide . ... Moscowљ? ... URALCHEM and Stamicarbon will develop a new technology for urea production . URALCHEM, a leading Russian producer of nitrogen fertilizers, signed a joint technology development agreement for the synthesis of urea with Stamicarbon, the world's top developer and licensor of urea processes. ... Laboratory of Chemical Thermodynamics љwasљestablished by Prof. Adam V. Rakovsky (corresponding member of USSR Academy of Sciences) first as a "halurgy laboratory" in 1930. ...
Заведующий кафедрой Head of the Chair . ... История кафедры . ... В 1966 г. для расширения ведущихся на кафедре научных работ в НИИ Ядерной физики МГУ был создан отдел физики плазмы (ОФП), в 1989 году переименованный в отдел микроэлектроники (ОМЭ). ... Сегодня по различным научным направлениям, ведущимся по специальностям, преподаваемым на кафедре атомной физики, физики плазмы и микроэлектроники, работает около 100 научных сотрудников, среди которых 12 докторов наук и около 50 кандидатов наук. ...
... The traditional answer to this question is unequivocal: тАЬno, public scholarship cannot and should not exist.тАЭ To popularize knowledge is to simplify, and simplification risks the loss of nuance and complexity, the very essence of scholarly knowledge. ... The public sphere can know but a distorted version of scholarly knowledge. ... You need JavaScript enabled to view it. (with Summer School-2016 in the subject line) before April 25, 2016. ... Summer School Archives . ...
... Voronin А. Каrmanov D. Savin А. Electronic engineer: . ... Engineer ? ... Electrical design of microprocessor systems, creating software for control and monitoring earth and satellite stations. ... Programming, electrical and layout design of test equipment for testing the silicon matrix for experiment ATIC (Advanced Thin Ionization Calorimeter), creating software for calibration. Electrical design of readout electronics, creating software for collecting and analysis data for experiment NUCLEON . ...
Научно-образовательный центр Геномного секвенирования МГУ . ... Sep 11, 2014, 9:17 AM . Yegor Bazykin attached NGS_supported_list.pdf to Результаты конкурса NGS-проектов . ... Yegor Bazykin deleted attachment NGS_supported_list.pdf from Результаты конкурса NGS-проектов . ... Yegor Bazykin edited Конкурс NGS-проектов . ... Yegor Bazykin created Результаты конкурса NGS-проектов . Jul 5, 2014, 2:53 AM . Yegor Bazykin updated polozhenie.pdf . ... Recent Site Activity | ...
... M.V.Lomonosov Moscow State University . ... Physicists from Lomonosov Moscow State University studied the dynamics of multiple cavitation bubbles excited by a fs laser superfilament and developed a new approach for their control by laser pulse energy and external focusing. For the first time an innovative method of controlling the dynamics of cavitation bubbles excited by the distributed laser-plasma source (filament) was demonstrated. ... 119991, Moscow, . ...
Chemistry of Heterocyclic Compounds, Vol. ... 8, 1995 INSTRUCTIONAL TECHNIQUE IN HETEROCYCLIC CHEMISTRY COMPUTER ANIMATION: A NEW METHOD AND REPRESENTATION IN HETEROCYCLIC FOR TEACHING, OF KNOWLEDGE COMMUNICATION, ABOUT REACTIONS CHEMISTRY E. V. Babaev We propose the use of computer animation techniques .for representation of knowledge about organic reactions, in particular as applied to syntheses and transformations of heterocTcles. ... Let us briefly consider the capabilities of this program. ...
... История курсов . ... close this panel . ... Выпускной класс . Старшие классы . Младшие классы . ... Прием на курсы . ... График мероприятий . ... Телефоны, адреса . График работы . ... Приветствуем вас на сайте Общеуниверситетских подготовительных курсов.љ ... Обращаясь на курсы через форму "Задать вопрос", будьте внимательны при написании своего электронного адреса.љ . ... Сайт общеуниверситетских . подготовительных курсовљ . ...
... An approach to the hybrid quantum mechanical and molecular mechanical (QM/MM) theory based on the effective fragment potential (EFP) technique (M. Gordon and co-authors) for modeling properties and reactivity of large molecular systems of biochemical significance is being developed. Currently we are preparing a novel version of the computer program based on the most recent variant of the PC GAMESS quantum chemistry package (A. A. Granovsky) and the TINKER molecular modeling package (J. Ponder). ...