... История курсов . ... close this panel . ... Выпускной класс . Старшие классы . Младшие классы . ... Прием на курсы . ... График мероприятий . ... Телефоны, адреса . График работы . ... Приветствуем вас на сайте Общеуниверситетских подготовительных курсов.љ ... Обращаясь на курсы через форму "Задать вопрос", будьте внимательны при написании своего электронного адреса.љ . ... Сайт общеуниверситетских . подготовительных курсовљ . ...

Еще в разделе: (Показать все результаты (>4) - oupk.msu.ru/ )

Synthesis and Use of Humic Derivatives Covalently Bound to Silica Gel for Np(V) Sequestration I.V. Perminova , L.A. Karpiouk, N.S. Shcherbina*, S.A. Ponomarenko§, St.N. Kalmykov, and K. Hatfield Department of Chemistry, Lomonosov Moscow State University, Moscow 119992, Russia Vernadsky Institute of Geochemistry and Analytical Chemistry, Russian Academy of Sciences, Moscow 119991, Russia § Institute of Synthetic Polymer ... I.V. Perminova, et al. ...

Еще в разделе: (Показать все результаты (>99) - mgumus.chem.msu.ru/ )

... M.V.Lomonosov Moscow State University . ... Physicists from Lomonosov Moscow State University studied the dynamics of multiple cavitation bubbles excited by a fs laser superfilament and developed a new approach for their control by laser pulse energy and external focusing. For the first time an innovative method of controlling the dynamics of cavitation bubbles excited by the distributed laser-plasma source (filament) was demonstrated. ... 119991, Moscow, . ...

Еще в разделе: (Показать все результаты (>62) - phys.msu.ru/ )

... Scientific educational events were organized at the Chair and the Faculty in the framework of the All-Russian School RESEARCH AND EDUCATIONAL PROJECTS on Global Social and Natural Processes in Interdisciplinary AND ACTIVITIES Studies as a joint action with the MSU Youth Council on Federal Task Program aimed at the inclusion of young Scientific research studies done by students of people in the scientific educational innovation processes the Chair and the Faculty were praised at the in Russia. ...

Еще в разделе: (Показать все результаты (>64) - fgp.msu.ru/ )

Space Weather . ... Space weather . ... Data . ... You should fill in "Workspace" by groups of data sets to create plots. ... Putting different kind of data into the same plot remember, that the first dropped data set chooses and determines the axis scale for all data. ... If you need both kind of scale in the same plot, create two different plots and unite them. The speed of this service depends on 3 components: data processing on server, data transmission and data plotting in your browser. ...

Еще в разделе: (Показать все результаты (>8) - swx.sinp.msu.ru/ )

Web of Science http://isiknowledge.com Web of Science , ( ) , . Web of Science. Search, Cited Reference Search Advanced Search, (Search History) (Marked List) 1. ... Science Citation Index Expanded (SCI-EXPANDED) ­ Social Sciences Citation Index (SSCI) ­ Arts & Humanities Citation Index (A&HCI) ­ . ... Marked List), . ... Analyse Results Create Citation Report. ... Cited Reference Search Web of Science , , / . Search (). ... Add to Marked List. Add to Marked List, , Marked List , . ...

Еще в разделе: (Показать все результаты (>4) - sinp.msu.ru/ )

• SINP MSU

Cassa depositi e prestiti spa Long-Term Instruments for financing Infrastructure Franco Bassanini Chairman of Cassa Depositi e Prestiti Institute of the Russian Academy of Sciences September 22, 2010, Moscow Cassa depositi e prestiti spa Global capitalism and short-termism · The short-termism that characterized recent global capitalism had negative effects on the ...

Еще в разделе: (Показать все результаты (>14) - www.mse-msu.ru/ )

• http://www.mse-msu.ru/Nekipelov_France_2010_Slides_Eng.pdf

RAPID COMMUNICATIONS PHYSICAL REVIEW A, VOLUME 62, 011802 R High-intensity pulsed source of space-time and polarization double-entangled photon pairs Yoon-Ho Kim,* Sergei P. Kulik, and Yanhua Shih Department of Physics, University of Maryland, Baltimore County, Baltimore, Maryland 21250 Received 4 April 2000; published 13 June 2000 Two spatially separated type-I nonlinear ... Two orthogonally oriented type-I BBO crystals are placed collinearly and pumped by 45° polarized femtosecond pulses. ...

Еще в разделе: (Показать все результаты (>109) - qi.phys.msu.ru/ )

• http://qi.phys.msu.su/papers/2006-jetp(e)-102-712.pdf
• Publications :: Quantum Information Laboratory

... Carbamide . ... Moscowљ? ... URALCHEM and Stamicarbon will develop a new technology for urea production . URALCHEM, a leading Russian producer of nitrogen fertilizers, signed a joint technology development agreement for the synthesis of urea with Stamicarbon, the world's top developer and licensor of urea processes. ... Laboratory of Chemical Thermodynamics љwasљestablished by Prof. Adam V. Rakovsky (corresponding member of USSR Academy of Sciences) first as a "halurgy laboratory" in 1930. ...

Еще в разделе: (Показать все результаты (>95) - td.chem.msu.ru/ )

• Colloquium on 21.02.08 Laboratory of Chemical Thermodynamics

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>11) - mouse.genebee.msu.ru/ )

... Likert-type scale response anchors. ... Level of Acceptability . ... Neutral . ... Level of Appropriateness . ... Level of Importance . ... Level of Agreement . ... Somewhat disagree . ... Somewhat agree . ... Never true . ... Rarely true . ... Sometimes but infrequently true . ... Sometimes true . ... Usually true . ... Always true . ... Somewhat true of me . ... Somewhat true of what I believe . ... Priority: . ... Somewhat priority . ... Priority Level . ... satisfied . ... Somewhat satisfied . ...

Еще в разделе: (Показать все результаты (>17) - tukachev.flogiston.ru/ )

Laboratory of Microfluidics and Nanofluidics . Laboratory of Physical Chemistry of Modified Surfaces . ... Research . ... Laboratory of Micro- and Nanofluidics . ... Professor B.V.Derjaguin moved to the Laboratory with his research group as an Emeritus Professor. ... In 1993 Professor Olga I. Vinogradova took over the leadership of the Laboratory. In 2009 the Laboratory of Micro- and Nanofluidics was organized by Professor Olga I. Vinogradova at the Physics Department of the M.V.Lomonosov MSU. ...

Еще в разделе: (Показать все результаты (>27) - nanofluidics.phys.msu.ru/ )

PHYSICAL REVIEW A, VOLUME 61, 052305 Analysis of radiatively stable entanglement in a system of two dipole-interacting three-level atoms I. V. Bargatin, B. A. Grishanin, and V. N. Zadkov International Laser Center and Department of Physics, M. V. Lomonosov Moscow State University, Moscow 119899, Russia Received 29 November 1999; published 7 April 2000 We explore the possibilities of creating radiatively stable entangled states of ... II only two transitions in the whole system. ...

Еще в разделе: (Показать все результаты (>60) - qilab.phys.msu.ru/ )

• http://qilab.phys.msu.ru/papers/FortschrPhys-2000-en.pdf
• http://qilab.phys.msu.ru/papers/PRA22309.pdf
• http://qilab.phys.msu.ru/papers/UFN-2001-44(6)-en.pdf

Заведующий кафедрой Head of the Chair . ... История кафедры . ... В 1966 г. для расширения ведущихся на кафедре научных работ в НИИ Ядерной физики МГУ был создан отдел физики плазмы (ОФП), в 1989 году переименованный в отдел микроэлектроники (ОМЭ). ... Сегодня по различным научным направлениям, ведущимся по специальностям, преподаваемым на кафедре атомной физики, физики плазмы и микроэлектроники, работает около 100 научных сотрудников, среди которых 12 докторов наук и около 50 кандидатов наук. ...

Еще в разделе: (Показать все результаты (>2) - www.affp.mics.msu.su/ )

... Multi-threaded search engines . ... Unfortunately, most documents on search engines I saw in the Internet were either lists of hyperlinks without any comments, or discussions about how many documents are in the database of ... (here is the name of a search engine) and what method of counting of the number of documents was used. No words about the efficiency, i.e. how many documents on some subject I can find using this search engine, especially in comparison with the other ones. ...

Еще в разделе: (Показать все результаты (>2) - scon155.phys.msu.ru/ )

... Dear creators of the Bensons courses! First of all I would like to thank you for such a magnificent English course! ... Look, it's really much more interesting - to listen to a virtual book, to look through the pictures, let alone role-play! ... However, I'm very glad that I took up "Bensons" - the course has given me wonderful possibilities to learn more about English culture, to fill some gaps in my knowledge of English grammar and just to spend my time with great pleasure and benefit! ...

Еще в разделе: (Показать все результаты (>8) - anazarenko.ffl.msu.ru/ )

• Факультет иностранных языков МГУ. Центр Дистанционного обучения.

... Electronic journal Issue 4. 10 september 2004 Vorontchuk, Cox III R.W. Developing a Competency-based Career Training and Professional Development Program for Latvia INTRODUCTION. ... With the support of a grant from the NISPAcee a team from the Latvian School of Public Administration, the University of Latvia and the University of Akron (Ohio, USA) prepared for the Chancellery of Latvia a proposal for the creation of a career-long professional development program for those in the civil service. ...

Еще в разделе: (Показать все результаты (>7) - e-journal.spa.msu.ru/ )

• http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./leigh.pdf
• http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./bonham_surin.pdf
• http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./paliulis_chlivickas.pdf

Head of sector, acting head of the Computational Geophysics Division of the M.V. Keldysh Institute for Applied Mathematics, RAS. ... Finished the Electrodynamics and Quantum Theory Department of Faculty of Physics, MSU in 1962. ... Ill-posed problems, stochastic processes, theory of approximation. Mechanics and physics of multi-phase media, phenomena in porous media, difference schemes for some classes of mathematical physics problems (filtration, elasticity theory). ...

Еще в разделе: (Показать все результаты (>4) - compmech.math.msu.su/ )

Thunderstorms and Elementary Particle Acceleration . ... Conference . The first announcement . ... The Thunderstorms and Elementary Particle Acceleration (TEPA-2012) conference is the second one devoted to the studies of the extreme atmospheric effects connected with amplification of electric fields in the lower atmosphere. ... TEPA-2012 conference will be held from July 9 till July 11, 2012, just after the 23rd European Cosmic Ray Symposium also organized by MSU ( http://ecrs2012.sinp.msu.ru ) . ...

Еще в разделе: (Показать все результаты (>2) - tepa2012.sinp.msu.ru/ )

... Инструкция по работе с информационными ресурсами в ОРОКС . ... Основные разделы сервера: Выбор раздела сервера ------------------------------------ На первую страницу "ChemNet" ------------------------------------ Химический факультет МГУ ------------------------------------ Электронная библиотека по химии ------------------------------------ Базы данных и другие источники информации по химии ------------------------------------ Периодические издания по химии -- Вестник МГУ. ...

Еще в разделе: (Показать все результаты (>3) - do.chem.msu.ru/ )