Nova 1998 2 in M31 this image of the second Nova in M31 in 1998, was made from 38 exposures of 45 seconds integration time. It was made at September 21, 22h 20m UT. Telescope was a CG11 at f/6.3, no filters were used. The long list of processing steps caused the artefacts at the overexposed center of the galaxy and in many of the brighter stars. During the exposures thin clouds covered the sky but the CCD cuts through them, allowing me to obtain this result. ...

Еще в разделе: (Показать все результаты (>7) - www.rochesterastronomy.org/ )

I. (SCIENCE CITATION INDEX ­SCI) WEB OF SCIENCE Web of Science (WoS) , , , , , Web of Science. ... Search>. ... WEB OF SCIENCE (SCIENCE CITATION INDEX) , Web of Science <Cited Reference Search>, , <Search>. ... Russian Acad Sci, Boreskov Inst Catalysis, Siberian Branch; - RAS, Boreskov Inst Catalysis SB; - SB RAS, Boreskov Inst Catalysis; - Boreskov Inst Catalysis; - Inst Catalysis; - Novosibirsk Catalysis Inst; - Boreskov Inst Catalysis SB RAS; - Boreskov Catalysis Inst; - GK Boreskov Inst Catalysis. ...

Еще в разделе: (Показать все результаты (>18) - cryst.geol.msu.ru/ )

• http://cryst.geol.msu.ru/odss/manual_r.pdf

... Nonlinear optics of ionized mediums . Fiber lasers . ... Emergence of powerful laser systems, being able to deliver powerful ultrashort light pulses, allows one to investigate and exploit new class of nonlinear-optical phenomena, based on the media ionization, when the electrons are released by strong electromagnetic field directly or by collision of an atom with another electron accelerated in the field. ... Ultrafast optical switching of an ionized medium by interfering ultrashort laser pulses. ...

Еще в разделе: (Показать все результаты (>3) - photonicslab.phys.msu.ru/ )

... ICONO Invited Speakers . ... Gennadiy Kulipanov, Budker Inst. of Nuclear Physics, Russia . ... Marlan Scully, Texas A&M Univ., ... Andrey Goncharov, Inst. of Laser Physics, Russia . ... Vladimir Trunov, Inst. of Laser Physics, Russia . ... Since 1987, he has worked at the National Research Council of Canada (Ottawa) in the field of laser physics and trapped ion optical frequency standards. ... Alexey Taichenachev , Inst. of Laser Physics, Russia . ... S. Vatnik, Inst. of Laser Physics, Russia . ...

Еще в разделе: (Показать все результаты (>7) - iconolat13.phys.msu.ru/ )

TB, SH, US, JPhysG/276799, 10/07/2008 IOP PUBLISHING J. Phys. G: Nucl. ... The ring-like and jet-like structures in two-dimensional angular histograms are well extracted by wavelet analysis both for toy models and in Monte Carlo simulated events of nucleus­nucleus collisions at LHC energies. ... We answer these questions by showing that the method of the wavelet analysis allows us to distinguish jets from rings and to find jet positions among the underlying backgrounds in Monte Carlo simulated events. ...

Еще в разделе: (Показать все результаты (>28) - lav01.sinp.msu.ru/ )

• http://lav01.sinp.msu.ru/nir/papers/NIM_CsI-D.pdf

... МГУ . ... Устав Студенческого комитета ИСАА МГУ был подписан 28 октября 2008 года, что и считается официальной датой основания организации, но история Студкома начинается еще в сентябре 2007 года, когда группа инициативных студентов собралась вместе, чтобы обсудить имеющиеся проблемы, с которыми сталкиваются проживающие в общежитии учащиеся ИСАА МГУ и реализовала самый первый проект "списки на заселение по комнатам с учетом пожеланий студентов" ( ранее списки составлялись по принципу свободных мест)...

Еще в разделе: (Показать все результаты (>2) - studkom.iaas.msu.ru/ )

... - behave-, believe-, blurred-, body- border- both-; ... , ... bottom-, bursary- but-, , ; ; , calculate-, capable-, , carry-, ~ away - ~out- Cartesian- case-, cause-; cathode- centre- 4 certainly-, champion- (- ), , , change-, , characterise-() characteristic-, ... weight- whereas- while-, whole-, wide-, , width- witness-, wonder- no ~ - worth- to be ~ doing smth- - Y yield- Z zinc- 35 ...

Еще в разделе: (Показать все результаты (>13) - www.eng.math.msu.su/ )

... Fluorescence induction curves registered from individual microalgae cenobiums in the process of population growth. ... Registration of chlorophyll fluorescence induction curves (IC) from individual microalgae cenobiums was performed during Scenedesmus quadricauda culture growth. ... Recording of the fluorescence induction curve for each individual cenobium was performed during 200 s. In the process of algae cultivation (52 days) 846 fluorescence kinetic curves were recorded. ...

Еще в разделе: (Показать все результаты (>15) - www.library.biophys.msu.ru/ )

Научно-образовательный центр Геномного секвенирования МГУ . Научно-образовательный центр геномного секвенирования факультета биоинженерии и биоинформатики МГУ объявляет конкурс на поддержку проектов, использующих методыљ высокопроизводительного секвенированияљ (NGS) и проводимых исследователями (исследовательскими группами) МГУ.љ ... в МГУ имени М.В. Ломоносова, проводимый научно-образовательным центромљгеномного секвенирования факультета биоинженерии и биоинформатики МГУ,љпоступило 23 заявки.љ ...

Еще в разделе: (Показать все результаты (>3) - genseq.fbb.msu.ru/ )

• call - НОЦ геномного секвенирования ФББ МГУ

... TWO USES OF ANCIENT ASTRONOMY . ... Limitations inciude lack of veracity in many records, errors in dating events, and uncertainty in calculating the circumstances of ancient eclipses of the Sun. ... Thus, in this paper, I shall discuss two and only two uses of ancient astronomy. ... This is the same as the time-equivalent precision of a solar eclipse, and hence an Islamic time observation is entitled to the same statistical weight as an observation of a total solar eclipse at a known point. ...

Еще в разделе: (Показать все результаты (>75) - hbar.phys.msu.ru/ )

... Подготовительные курсы для поступающих . Курсы иностранных языков . ... Курсы английского языка . Курсы китайского языка . Курсы японского языка . ... МГУ . ИСАА МГУ . 495) 971-3636 . ... Если Ваш ребенок определился и хочет поступать в гуманитарные вузы Москвы, то мы ему рекомендуем обучение на Подготовительных курсах Института стран Азии и Африки (ИСАА) Московского государственного университета имени М.В. Ломоносова в ?Центре подготовки к ЕГЭ? по гуманитарным дисциплинам. ...

Еще в разделе: (Показать все результаты (>2) - courses.iaas.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>2) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

... Okhapina, E. Y. The Boundary Zones of the Eastern Urals . Natural restrictions of the East Uralian structures are two intensive deformed boundary zones, which are the Sheludivy Gory Boundary Zone (SGBZ) in the west and the Redutovo Boundary Zone (RBZ) in the east. SGBZ represents a package lens-shaped and steeply dipping faulted blocks, horizontal dimension of which usually does not exceed 2 km. ... Deformation degree in this boundary zone are significantly higher than in the former. ...

Еще в разделе: (Показать все результаты (>9) - sbmg.geol.msu.ru/ )

• Список элементов HTML
• Calendar Converter

День Физика . Преподаватели физфака . ... Главная Программа Дня физика . Встреча вконтакте: Турнир по киберспорту ДФ 2012 . ... Название команды . ... Игровой мод: -cd (в расчет идут первые 3 пика,остальные допикиваются рандомно и в игре быть использованы не могут) . ... Правила турнира: . ... В случае если игрок остановил игру(поставилпаузу), возобновляет игру соперник (получив согласие первого игрока) или судья. ... Использование Duck+Jump определяется регламентом конкретного турнира. ...

Еще в разделе: (Показать все результаты (>3) - www.dubinushka.ru/ )

... Белега Е.Д., Рыбаков А.А., Трубников Д.Н., Чуличков А.И. Эффективная размерность фазовой траектории в задаче визуализации эволюции динамической системы // Ж. вычисл. матем. и матем. физ., ... Белега Е.Д., Рыбаков А.А., Трубников Д.Н., Чуличков А.И. Эффективная размерность фазовой траектории и моды движения динамических систем // Математика. ... Белега Е.Д., Рыбаков А.А., Трубников Д.Н., Чуличков А.И. Моды . ... Рыбаков А.А., Белега Е.Д., Трубников Д.Н., Чуличков А.И. Порядок . ...

Еще в разделе: (Показать все результаты (>20) - beams.chem.msu.ru/ )

University Satellites and . Space Science Education . ... Abstract Submission List of submitted abstracts . Registration List of registred participants . ... LINK=http://eeqanfrelwi.150m.com/banner-free-rotation-script.html]banner free rotation script[/LINK] . ... The list of abstracts submited . Skobeltsyn Institute of Nuclear Physics, Moscow State University, 2005-2006 . ...

Еще в разделе: (Показать все результаты (>26) - cosmos.msu.ru/ )

• Space Scientific and Education project of Lomonosov Moscow State University

... Twenty five years ago the first Russian papers dedicated to Surface Nonlinear Optics were published. This 25th anniversary allows us to look back on the early 1980s, the time of appearance of Surface Nonlinear Optics as a branch of Optics. Pioneering works by Prof. Y.R. Shen in the early 1980s, which were based on the 1960s fundamental ideas of Prof. N. Bloembergen, stimulated an explosion of such studies at Moscow State University and around the world. ... March 2008 ...

Еще в разделе: (Показать все результаты (>23) - shg.phys.msu.ru/ )

... SPAND- `TO LIBATE': ONE MORE CASE OF LUVIAN INFLUENCE ON NEW HITTITE It is well-known that the syllabic cuneiform writing is not fit for the unambiguous representation of word-initial consonant clusters.1 The phonological sequence /C1C2-/ can only be represented as either C1V-C2V- or VC1-C2V- in syllabic orthography, and in neither of the two cases can one be a priori sure whether the vocalic component of the first syllabic sign is phonetically real. ... On initial *sm- in Hittite, cf. ...

Еще в разделе: (Показать все результаты (>15) - imk.msu.ru/ )

• http://www.imk.msu.ru/Structure/Linguistics/yakubovich/download/palaic1.pdf
• http://www.imk.msu.ru/Structure/Linguistics/yakubovich/download/Hieroglyphs.pdf
• http://www.imk.msu.ru/Structure/Linguistics/yakubovich/download/lydian.pdf

... Пущаровский Д.Ю. (главный редактор) доктор геолого-минералогических наук, профессор, декан геологического факультета, академик РАН; . ... Габдуллин Р.Р. (ответственный секретарь) кандидат геолого-минералогических наук, доцент, доцент кафедры региональной геологии и истории Земли; . Барсков И.С. доктор биологических наук, профессор, заведующий кафедрой палеонтологии; . ... Короновский Н.В. доктор геолого-минералогических наук, профессор, заведующий кафедрой динамической геологии; . ...

Еще в разделе: (Показать все результаты (>3) - geol.msu.ru/ )

... В сентябре 2005 года компания "Т-Платформы" поставила 13-узловой кластер T-Edge26 на базе 26 процессоров Intel Xeon с технологией Intel EM64T и интерконнекта Gigabit Ethernet для Лаборатории высокопроизводительных компьютерных систем Нижегородского государственного университета. ... Кластер используется для практических занятий студентов по параллельному программированию, а также для решения научно-практических задач, в числе которых: . ... исследования в области Grid технологий . ...