Еще в разделе: (Показать все результаты (>51) - dfgm.math.msu.su/ )

• Носовский Г.В. / Кафедра Дифференциальной геометрии и приложений /

... Доктор филологических наук профессор Юрий Николаевич МАРЧУК является видным специалистом по прикладной и компьютерной лингвистике , машинному переводу, автоматическому анализу и синтезу текстов, терминологии и терминоведению, лексикологии и лексикографии, общему языкознанию. ... Белов Алексей Михайлович, преподаватель, кандидат филологических наук . ... Качалкин Анатолий Николаевич, профессор, доктор филологических наук . Кочергина Вера Александровна, профессор, доктор филологических наук . ...

Еще в разделе: (Показать все результаты (>40) - genhis.philol.msu.ru/ )

... Winner of joint DAAD (German Academic Exchange Service) and Moscow State University Scholarships Program ?Vladimir Vernadskii? for joint research in Germany. 2011-present. ... 16.11-12.12.2009, Collaborative Research Center 701 of Bielefeld University, Bielefeld, Germany. ... Another ham sandwich in the plane? (joint work with Alexey Balitskiy and Roman Karasev from Moscow Insitute of Physics and Technology), November 9, 2013, Kolloquium Kombinatorik, TU Ilmenau, Ilmenau, Germany. ...

Еще в разделе: (Показать все результаты (>136) - higeom.math.msu.su/ )

• Conferences (English)
• Alexey Garber (Russian)
• english

. РЕЙТИНГ СЛУХОВ . о проекте права пишите нам .

Еще в разделе: (Показать все результаты (>2) - www.niiss.ru/ )

. SVETKA, a program for Analysis of Multiple Sequence Alignments . Helps (useful info) . Analyse your alignment . Interesting . links . Our Country . loads for a long time! . Our City . Our University . Our Institute . Our seminar . Our project . Name (optional) . Alignment . Nota Bene! .aln or .fasta format required!!! . Look here for comments . Tree (optional) . Nota Bene! Special scheme format required! . Look here for comments .

Еще в разделе: (Показать все результаты (>45) - monkey.belozersky.msu.ru/ )

• SVETKA, a program for multiple sequence alignments analysus
• Internet Services

Software Protection: How to Crack Programs, and Defend Against Cracking" In the first part of this course we will learn how to "crack" programs, i.e.how hackers break into software to extract secrets, remove license checks, etc. ... Learning about this type of computer security is important because many current systems are vulnerable to cracking attacks. ... The course will have practical homework exercises where you will crack small programs, and use tools to protect against cracking. ...

Еще в разделе: (Показать все результаты (>3) - master.cmc.msu.ru/ )

Y. A. Plyushkyavichyute yuratep@student.ethz.ch EVALUATION OF POSSIBLE CARTOGRAPHIC AND REMOTE SENSING METHODS FOR DETECTING TEMPORAL CHANGES IN THE URBAN AREA IN THE ALPINE REGION Swiss Federal Institute of Technology, Zurich ABSTRACT This project explores the potential of Cartographic and Remote Sensing approaches in the study of Alpine urban region in order to detect the temporal changes. ... Result 1: Cartographic approach, raster analysis. ... Result 3: Remote Sensing Approach, NDVI analysis. ...

Еще в разделе: (Показать все результаты (>342) - www.geogr.msu.ru/ )

• Editorial Board
• CONTENT 1 (5) 2012
• CONTENTS ?2 - 2009

... pobedria@member.ams.org . ... Since that time he has read the following courses of lectures: Mechanics of Continuous Media, Numerical Methods, Classical Mechanics, Mechanics of Solids, Theory of Elasticity and Plasticity, Tensor Analysis, Theory of Viscoelasticity, Composites Mechanics, Stability of deformation processes, Mathematical theory of Shells, Dynamic problems of the Composites Mechanics. ... Member of the European Community on Computational Methods in Applied Sciences (ECCOMAS)(1996) . ...

Еще в разделе: (Показать все результаты (>4) - composite.msu.ru/ )

• INTAS 95-525 Final Reprort (Short version)

Please enter the lightcurve file name and period search parameters: . Lightcurve file: . ... Apply the Heliocentric correction and convert all dates to Terrestrial Time (TT)? ... Also, the Heliocentric correction cannot be applied to such lightcurves. ... This period search service is also available at the mirror sites: Mirror 1 , Mirror 2 , Mirror 3 , Mirror 4 . You may download the latest source code distribution and install the period search service at your own web server. ...

Еще в разделе: (Показать все результаты (>2) - scan.sai.msu.ru/ )

... Aleksandrova Luydmila Vasilyevna (Moscow) . ... Tel.: 954-50-98, 403-14-49 . ... Andreeva Marina Victorovna (Moscow) . ... Tel.: 8 916 844 51 11 . ... Anoshkina Zhanna Grigoryevna (Moscow) . ... Tel.: (095) 939-51-15 j2@ffl.msu.ru . ... Infocommunication as a factor influencing the professional socialization of future language teachers . Tel.: 68-06-44 . ... Using multimedia in teaching professional communication to future teachers . ... Дистанционный курс английского языка "Bensons" . ...

Еще в разделе: (Показать все результаты (>13) - anazarenko.ffl.msu.ru/ )

... M.V.Lomonosov Moscow State University Department of Physics, . ... 5-th All-Russian Conference . Nitrides of gallium, indium and aluminum: structures and devices " . ... Four All-Russian Conferences "Nitrides of Gallium, Indium and Aluminum: structures and devices" took place in Russia during 2001-2005 (in Moscow and St.-Petersburg). The conferences enjoyed the support from RFBR and the Ministry of Industry and Science. ... Nitrides of Gallium, Indium and Aluminum: structures and devices". ...

Еще в разделе: (Показать все результаты (>3) - www.ccl.msu.su/ )

• 5-th All-Russian Conference - Timetable

... On the Institute . ... Development of relational methods of studying time [Chief: V.V. Aristov, Dr. Sci. (physics and mathematics)] . ... Physics of relic radiation, fundamental interaction mediator, carrier of space and time [Chief: I.M. Dmitrievsky, PhD (technology), Ass. ... Algebraic structure of space-time, algebrodynamics of fields and particles [Chief: V.V. Kassandrov, PhD (physics and mathematics)] . ... Causal mechanics [Chief: S.M. Korotaev, Dr. Sci. (physics and mathematics)] . ...

Еще в разделе: (Показать все результаты (>21) - temporology.bio.msu.ru/ )

• Russian Roulette / Русская Рулетка

СПИСОК ПУБЛИКАЦИЙ . ... к.ф.-м.н. Ровенской Елены Александровны . ... Е.А. Ровенская. ... E.A. Rovenskaya, V.V. Savin . ... E.A. Rovenskaya. Optimal Compatibility and Its Applications // Journal of Nonlinear and Convex Analysis, 2009, 10(1): 51-72 . ... Ю.С. Осипов, А.В. Кряжимский, Е.А. Ровенская. ... Е.А. Ровенская , А.А. Володин, В.Б. Гласко , С.В. Родионов. ... Е.А. Ровенская, А.В. Кряжимский, В.И. Максимов, М.В. Родкин . ... Е.А. Ровенская, Д.Г. Пивоварчук. ... Е.А. Ровенская, У. Лехмийоки . ...

Еще в разделе: (Показать все результаты (>9) - oc.cs.msu.ru/ )

• CURRICULUM VITAE

... General Information . ... For physics faculty . ... For natural faculties . ... Institute of General Physics RAN (Moscow) . ... Kazan State University (Kazan) . ... the science laboratories and group of the department have broad contacts with science and educational institutions around the globe: . ... Institute of Solid State Physics, Tokyo University . ... Institute of Solid State Physics, Vienna University of Technology . ... Institute of General Physics, Dresden Technical University, Germany . ...

Еще в разделе: (Показать все результаты (>18) - ferro.phys.msu.ru/ )

• Laboratory of Rare Earth Intermetallics
• Laboratory of Ferroelectricity

Curriculum Vitae of Dr Alexei A. Mailybaev . ... A.P. Seyranian and A.A. Mailybaev, Multiparameter Stability Theory with Mechanical Applications , World Scientific, New Jersey, 2004. ... A.A. Mailybaev and A.P. Seyranian, Bifurcations of equilibria in potential systems at bimodal critical points, Journal of Applied Mechanics 75 (2008), 021016. ... A.P. Seyranian and A.A. Mailybaev, On stability boundaries of conservative systems, Journal of Applied Mathematics and Physics (ZAMP) 52 (2001), 669-679. ...

Еще в разделе: (Показать все результаты (>32) - mailybaev.imec.msu.ru/ )

• Dr Alexei A. Mailybaev
• Multiparameter Stability Theory with Mechanical Applications

... Fast Facts about the Faculty of Journalism . ... Academic Departments . ... Partners . ... All partners . ... The Department of Photojournalism and Media Technologies exists at the Faculty of Journalism since 1962 (former name The Department of Technology of Newspaper Business and Mass Media).љ The first head of the department was a well-known polygraphist, Associate Professor V.V. Popov. ... 1999-2014 Faculty of Journalism, Lomonosov Moscow State University . ...

Еще в разделе: (Показать все результаты (>77) - www.journ.msu.ru/ )

• Photo project by Chair of Photojournalism and Media Technologies: ?Veterans of
• Professor Tony Maniaty (University of Technology Sydney, Australia) delivered a
• About MSU :: Department of Journalism, M. V. Lomonosov Moscow State University

... Поиск . по всему сайту по геол. сайтам в каталоге в форумах в словаре в конференциях . ... Геология >> Поиск и разведка месторождений полезных ископаемых | Анонсы конференций . ... V Международная конференция "Нетрадиционные и интенсивные технологии разработки месторождений полезных ископаемых" . 1.11.2001 | ... V Международная конференция "Нетрадиционные и интенсивные технологии разработки месторождений полезных ископаемых" будет проходить в ноябре 2001 года в России, г. Новокузнецк. ...

Еще в разделе: (Показать все результаты (>56) - phys.web.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>5) - mouse.genebee.msu.ru/ )

... - behave-, believe-, blurred-, body- border- both-; ... , ... bottom-, bursary- but-, , ; ; , calculate-, capable-, , carry-, ~ away - ~out- Cartesian- case-, cause-; cathode- centre- 4 certainly-, champion- (- ), , , change-, , characterise-() characteristic-, ... weight- whereas- while-, whole-, wide-, , width- witness-, wonder- no ~ - worth- to be ~ doing smth- - Y yield- Z zinc- 35 ...

Еще в разделе: (Показать все результаты (>15) - www.eng.math.msu.su/ )

• English test

M obile A stronomical Sy stem of TE lescope- R obots MASTER-II Kislovodsk Lomonosov Moscow State University, Sternberg Astronomical Institute , Moscow Union "Optic" , Kislovodsk Solar Station Latitude = 43 o љ44'.767љN; Longitude = 42 o љ31'.417љE; Altitude = 2067љm MASTERљIIљ(8љsquareљdegress) + MASTERљVWF(VeryљWideљFieldљCameras (FOV=800 square degrees, Timeљresolutionљupљtoљ150љms, with unfiltered m_lim=14m on 5 sec. exposure, and ~10.5m with 0.15 sec) . ... 11h 38m 38.0s , -09d 59m 59s) . ...

Еще в разделе: (Показать все результаты (>2) - apollo.sai.msu.ru/ )