... The latter should be taken into account and carefully modeled as a fluid-structure interaction (FSI) problem. A patient- specific FSI analysis is impossible because it predicts only estimated hemodynamic features which are based on assumptions regarding material properties. The objective of this study is to develop a new methodology that assimilates medical imaging data for quantitative hemodynamic data extraction. ...
[
Текст
]
Ссылки http://hit-conf.imec.msu.ru/2012/lectures/Yakhot-abstract.doc -- 21.5 Кб -- 14.06.2015 Похожие документы
... Introduction to the contemporary phylogenetics ( a cladogenetic aspect). ... The book contains a review of theoretical fundamentals, principles, notions, methods, and applications of the contemporary phylogenetics (with emphasis on its cladogenetic aspect). ... Principal algorithms and methods of numerical phyletics are briefly outlined, including numerical estimates of phylogenetic relationship and recent methods of constructing phylogenetic trees (compatibility, parsimony, maximum likelihood , etc...
... TUS Ultra high energy cosmic ray detector on-board the Lomonosov satellite . ... We present the simulation framework CRPropa version 3 designed for efficient development of astrophysical predictions for ultra-high energy particles. Users can assemble modules of the most relevant propagation effects in galactic and extragalactic space, include their own physics modules with new features, and receive on output primary and secondary cosmic messengers including nuclei, neutrinos and photons. ...
... Science Park . ... Agency for networking, information and communication technologies ( NETINFOKOM LLC) ank-nic@rambler.ru http://www.msunews.ru/ . ... Developing the infrastructure and information support needed for projects that provide an interdisciplinary exchange of science information and the potential for collective work on the base of network services and technologies. ... The company has a great deal of experience in the design, development and penetration of laboratory information systems. ...
BS - 2D data processing program. BS is a windows version of the 2D X-ray data processing program BSL in use at the Daresbury Synchrotron radiation source, for the treatment of low angle diffraction data. ... It requires less memory, has separate window to see 1D graphics and allows export of the image in two common formats: BMP and TIFF. ... information about the data file .adc . add a constant to selected range in n frames from file .add . weighted addition of two images .arg . ...
... Lomonosov Moscow State University . ... Home About The Department of land resources . ... The main tasks of the Department is the development of methods for effective land management aimed at sustainable development and food security, implementing technology for soil protective land using, analysis of the current state of land resources, assessment of land degradation and water quality reduction. ... The Department of land resources is headed by doctor of biological Sciences Pavel Krasilnikov. ...
Using Site testing data for Adaptive Optics simulations Kislovodsk, October 2010 1Glen Herriot, 1David Andersen, 1Jean-Pierre VИran, 2Brent Ellerbroek, 2Luc Gilles, 2Lianqi Wang 1National Research Council Canada Herzberg Institute of Astrophysics 2TMT Project Office, Pasadena TMT.AOS.PRE.10.074.REL01 1 Outline TMT / NFIRAOS Site Testing Parameters and their value for Adaptive Optics Simulations ... TMT.AOS.PRE.10.074.REL01 9 What is the interest of Adaptive Optics in r 0 Seeing ? ...
[
Текст
]
Ссылки http://site2010.sai.msu.ru/static/doc/GHerriot_site2010.ppt.pdf -- 1942.1 Кб -- 18.10.2010 Похожие документы
... ICONO Invited Speakers . ... Gennadiy Kulipanov, Budker Inst. of Nuclear Physics, Russia . ... Marlan Scully, Texas A&M Univ., ... Andrey Goncharov, Inst. of Laser Physics, Russia . ... Vladimir Trunov, Inst. of Laser Physics, Russia . ... Since 1987, he has worked at the National Research Council of Canada (Ottawa) in the field of laser physics and trapped ion optical frequency standards. ... Alexey Taichenachev , Inst. of Laser Physics, Russia . ... S. Vatnik, Inst. of Laser Physics, Russia . ...
Alexander P. Seyranian . Institute of Mechanics , . Moscow State Lomonosov University , . ... Phone: (7495) 939 2039 . Fax: (7495) 939 0165, 939 2065 . ... My field of specialization are Stability Theory, Parametric Resonance, Gyroscopic Stabilization, Mechanics of Solids, Structural Optimization, Singularities and Bifurcations. ... Technical University of Denmark . Aalborg University, Denmark . ... Institute of Engineering Mechanics and Systems, University of Tsukuba, Japan . ...
... Доктор филологических наук профессор Юрий Николаевич МАРЧУК является видным специалистом по прикладной и компьютерной лингвистике , машинному переводу, автоматическому анализу и синтезу текстов, терминологии и терминоведению, лексикологии и лексикографии, общему языкознанию. ... Белов Алексей Михайлович, преподаватель, кандидат филологических наук . ... Качалкин Анатолий Николаевич, профессор, доктор филологических наук . Кочергина Вера Александровна, профессор, доктор филологических наук . ...
ABSOLUTE PROPER MOTIONS OF 331 OPEN CLUSTERS . ... The proper motions of stars in the fields of 331 open clusters were taken from Four-Million Star Catalog (4M-catalog) of positions and proper motions (Volchkov et al. ... The absolute proper motions for 21 young open clusters have been derived by comparison of precise relative proper motions of individual stars and their corresponding absolute proper motions. ... Sign of proper motions in RA . ... 0.0001 arcsec/yr . ... rms error in RA proper motion . ...
... CUDA Showcase - список приложений, использующих CUDA (на сайте NVidia). RapidMind Case Studies - примеры использования RapidMind для программирования ГПУ (и не только). AMD Stream Computing Blog - примеры использования вычислительной платформы AMD Stream Computing для программирования ГПУ от AMD. Core Image - компонент интерфейса программирования Mac OS X, использующий вычислительные мощности графического процессора для отрисовки эффектов пользовательского интерфейса. ...
FNAL SELEX experiment. ... Моя Atlas страница здесь, в МГУ. ... Страница памяти Юрия Александровича Лазарева . ... Л.Д. Ландау ? ученый, учитель, человек?(.pdf) . ... Круг Ландау: Физика войны и мира?. 2009 г., 269 стр.) ... Л.Д. Ландау?(.pdf) . 32 стр.) ... Бонсай в Москве, декабрь 2015 г. Южная Индия в январе 2011 г. Петербург в ясном октябре 2010 г. Фото на станции метро Лубянка после теракта 29 марта 2010 г. (30 марта и 6 апреля). ... Фото Гелл-Манна , выступавшего в МГУ 25.09.2007. ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
Russian TeX Disk . ... Please, use "Save link as" (right mouse button) for downloading files, otherwise binary files will be corrupted. What is russian TeX disk . ... Some TeX versions and tools are installed/russified and can be started directly from CD; other are only distributives plus additional files for their russification. ... FPTEX . ... Directory russian.add: Generic files (mf-sources, pfb-fonts and hyphen file) for russification of any-TeX-realizations in: . ... file readme: . ...