... Practical courses . ... The architecture of data acquisition and control systems systems and laboratory works employs various types of plug-in boards, CAMAC modules, GPIB boards, original connecting cards and virtual generators, breadboard modules, and sound blasters, which are used as generators of analog signals of different shapes and as analog-to-digital converters. ... Pascal and C++ are employed to program the different blocks of data acquisition and control systems systems. ...

Еще в разделе: (Показать все результаты (>4) - ilc.phys.msu.ru/ )

Restraint-based 3D Shape Manipulation Method using Hand Gestures for Interactive Molecular Dynamics Ryohei Suzuki, Daisuke Komura, Shumpei Ishikawa Department of Genomic Pathology, Medical Research Institute, Tokyo Medical and Dental ... 4] Thus the input method for specifying external forces given to atoms is a central problem of IMD system design. ... 2001) A system for interactive molecular dynamics simulation, In Proceedings of the 2001 symposium on Interactive 3D graphics (pp. ...

Еще в разделе: (Показать все результаты (>67) - mccmb.belozersky.msu.ru/ )

• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/181.pdf
• MCCMB'15 - OpenConf Peer Review & Conference Management System

... IM2, c (2222430 nt) initn: 382 init1: 382 opt : 402 Z-score: 427.8 bits : 96.2 E(75): 3.7e-20 banded Smith-Waterman score: 402; 64.1% identity (64.1% similar) in 234 nt overlap (68- 300 :1090800-1091033) 40 50 60 70 80 90 NC_000 TAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTC-CGT :: : ::: :::: :: :: :: :: AE0094 AAGAGCCCGGCTTTTGCCCGGTCTAAAACGCCGGGCGAATAAGCGGGGGGCAAGTCTGGT 1090770 1090780 1090790 1090800 1090810 1090820 100 110 120 130 140 150 ...

Еще в разделе: (Показать все результаты (>2) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

Diploma thesis abstract Gamma-ray emission of plasma produced by superintense laser pulse and its application for lowlying nuclear states excitation Student: Research supervisor: Sergey A. Shulyapov Ph.D., Dr.Sc., ... Solid-body targets (Pb, Fe and SiO2) were irradiated by laser pulses of subrelativistic (I ~ 10 18 W/cm2) intensity. An increase of hot electrons plasma subsyste m temperature was discovered in case of long chirped laser pulses application. ...

Еще в разделе: (Показать все результаты (>16) - ofvp.phys.msu.ru/ )

• http://ofvp.phys.msu.ru/en/science_education/diploma/annot/2008/Khakhalov_Zheltikov_en.pdf
• http://ofvp.phys.msu.ru/en/science_education/diploma/annot/2011/Nikitin_Pelivanov_en.pdf
• http://ofvp.phys.msu.ru/en/science_education/diploma/annot/2011/Trukhanov_Bruevich_en.pdf

SELECT data_key, data_value FROM xf_data_registry WHERE data_key IN ('options', 'languages', 'contentTypes', 'codeEventListeners', 'cron', 'simpleCache', 'routesPublic', 'bannedIps', 'styles', 'nodeTypes', 'smilies', 'bbCode', 'displayStyles', 'trophyUserTitles', 'reportCounts', 'moderationCounts') . Run Time: 0.000535 . Select Type . ... Type . ... SIMPLE . ... PRIMARY . ... const . ... library/XenForo/ Autoloader.php . ... library/Zend/Registry.php . ... library/Zend/Db/Select.php . ...

Еще в разделе: (Показать все результаты (>24) - osk.msu.ru/ )

• http://osk.msu.ru/forum/forums/faq.8/?_debug=1

The Converter of Measurement Units is aimed to converting of measurement units between different systems of measurement, for example from British-American units of measurement to metric system and vice versa. To convert a value . ... On the left panel list select a measure you want to convert . ... Select the measurement unit you want to convert from . ... Select the measurement unit you want to convert to . ... Result is displayed in the "Conversion Result" area. ...

Еще в разделе: (Показать все результаты (>4) - sbmg.geol.msu.ru/ )

• Список элементов HTML
• Форма 502

... Выберите Моя библиотека Библиотека 5.х Эйдос Протокол Z39.50 Библиотека 4.02 -> 5.x Библиотека 4.02 Куб Общие вопросы Сигла Эйдос 4.0 ТрансЭйдос . ... Система. ... Не работает русский язык в Библиотеке 4.02. ... Компания 'Библиотечная компьютерная сеть' разрабатывает и внедряет Автоматизированные библиотечные информационные системы ( АБИС ): каталогизатор книг - создание электронного каталога библиотеки , учет книг . ...

Еще в разделе: (Показать все результаты (>3) - www.bks-mgu.ru/ )

... Вид 0 - 25 26-100 100-300 Больше 300 . ... Большая синица 15 11 . ... Дубрава (10Д, подлесок - лещина, бересклет бородавчатый, подрост - дуб, липа, вяз), расстояние - 5.5 км . ... Сосняк (10С, подрост - ель, подлесок - лещина, рябина), расстояние - 15 км . ... Смешанный лес (5Б5Ос, Е+,Д+, подлесок - бересклет бородавчатый, лещина, жимолость, подрост - ель, дуб, клен), расстояние - 36.5 км . ... Ельник (7Е3Б, подрост - ель, подлесок - жимолость, бересклет бородавчатый, лещина), расстояние - 15 км . ...

Еще в разделе: (Показать все результаты (>4) - www.ecocoop.ru/ )

Poligraphic complex (printing plant) - humanitarian aid from RRU to South Ossetia A.A. Tibilov State University The printing plant is intended to make a wide range of materials - textbooks, manuals, presentations, reports, informational and commercial printed matters. ... wide color range, surpassing that of offset printing; . ... simple operation and high reliability. [pic] Besides the printer, there is a digital color copier Duplo DPS850 (Japan) size A3, in the printing complex. ...

Еще в разделе: (Показать все результаты (>9) - www.rsr-online.ru/ )

... OPLS-AA topology generation is a very complex task because of huge amount of the atomtypes described this force field. ... TPPMKOP is an utility developed for the automatic topology generation working well with OPLS-AA force field. ... This database is continually upgrading by our research group. ... OPLS-AA patch for different types of molecules ERG Research Group: Лаборатория теоретической биофизики написал (Февраль 8th, 2016 4:27 дп) . ... All-atom automatic OPLS-AA topology generator . ...

Еще в разделе: (Показать все результаты (>28) - erg.biophys.msu.ru/ )

• Using Firefly/GAMESS-US efficiently ERG Research Group: Лаборатория
• Visual approach to construction of &QMMM section of CP2K input file ERG

Windows CP1251 . Dynamic of crust thickness under collision (from the modeling). при коллизии. Deformation of a crust, calculated from model taking into account erosion and sedimentation and elastic properties of undercrust lithosphere. Velocities of viscous flow in in lower crust (from the modeling). Thermal history of collision zone (from the modeling). Differences with the "normal" temperature field in collision zone (from modeling). Page design: ©V.Zakharov . ...

Еще в разделе: (Показать все результаты (>12) - dynamo.geol.msu.ru/ )

• http://dynamo.geol.msu.ru/personal/vsz/papers/Zakharov_2012_eng.pdf
• V.Zakharov's Ph.D. thesis

... The results are compared to the hydration curves, fatty acid composition and the structure-dynamic and functional characteristics of the membranes of photosynthetic bacteria Rb. sphaeroides, Rhodospirillum rubrum and Ectothiorhodospira shaposhnikovii. ... Based on the results obtained and the data on model systems, four stages of hydration process are distinguished with different effects on the structure and dynamics of membrane components. ...

Еще в разделе: (Показать все результаты (>13) - www.library.biophys.msu.ru/ )

• ЖИЗНЕСПОСОБНОСТЬ ПОПУЛЯЦИЙ ПРИ ИМПУЛЬСНОМ ВОЗДЕЙСТВИИ ТОКСИКАНТОВ

... Coordination of economic policies and convergence of economic performance are fundamental to the integration of national economies in the Community. ... When U.S. President Barack Obama enters his White House meeting with Israeli Prime Minister Benjamin Netanyahu on March 5 -- angling to dissuade Israel from attacking Iran's nuclear facilities -- there will be one seemingly mundane issue on his mind that he may be too uncomfortable to share with his guest: gasoline prices. ... 2004. ...

198. http://ndsipu.cmc.msu.ru/files/Kraev/MATLAB_FOR_STUDENTS.DOC

---

Астронет | Научная сеть | ГАИШ МГУ | Поиск по МГУ | О проекте | Авторам

Комментарии, вопросы? Пишите: info@astronet.ru или сюда