... 15 2.1 Stuxnet .. ... 25 2.2 Wiper .. ... IT- ( , ) , Stuxnet, Flame, Gauss, Duqu, Wiper Icefog. ... Microsoft Windows (DLL) . ... 17 ; -- Microsoft, ­ , ­ ; , ; Windows rootkit, ; ; «» Siemens, ; , , , rootkit . ... MS08-067 ( 2009 Kido, 20 ) MS10-061 (zero-day ); (zero-day ) MS10-073 (Windows 2000 XP) MS10-092 (Windows Vista, x64), , ; Stuxnet peer-to-peer (P2P) ; , , ; e SIMATIC, Siemens, , , . ... 38 - : http://www.securelist.com/ru/blog/207764003/Flame_Bunny_Frog_Munch_i_BeetleJuic e ­ Hiew. ...

Еще в разделе: (Показать все результаты (>6) - iisi.msu.ru/ )

... Second-year students classes . ... The course offers profound description of popular techniques of parallel programming such as OpenMP and MPI. ... Rapid growth of productivity of the modern computing systems is achieved by using parallel processors and multicore systems. ... As a result, by the and this course, students acquire knowledge about the popular parallel programming techniques, knowledge of modern high-performance computing systems and practical skills to work with them. ... Moscow: Binom...

Еще в разделе: (Показать все результаты (>4) - engineering.phys.msu.ru/ )

• FPGA Design

... АНАТОЛИЙ ТИМОФЕЕВИЧ ТЕРЕХИН ANATOLY TEREKHIN (TERIOKHIN) . ... Будилова Е.В., Терехин А.Т. Математическое моделирование эволюции жизненного цикла: краткая история и основные направления// Журнал общей биологии, 2010. ... Ponton F., Duneau D., S?nchez M., Courtiol, A., Terekhin A.T., Budilova E.V., Renaud F., Thomas F. Effect of parasite-induced behavioral alterations on juvenile development. ... Терехин А.Т., Будилова Е.В. , Понтон Ф., Дюно Д., Санчес М., Мур Дж., ... Терехин А.Т., Будилова Е.В . ...

Еще в разделе: (Показать все результаты (>11) - ecology.genebee.msu.ru/ )

... Linguistic expeditions . ... Logical and stylistic aspects of lexical semantics . ... Linguistic phenomena can be approached and described from various perspectives. ... The approach proposed here is distinctive in that it is based on logic and stylistics, which are usually considered marginal to the description of linguistic phenomena. ... A special focus in the present approach on parallel texts is directly connected with translation . ...

Еще в разделе: (Показать все результаты (>4) - lcl.srcc.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>2) - mouse.genebee.msu.ru/ )

Evgeny Antipov (Moscow U) Q: What structural type is more preferable for practical applications? It depends on the type of application. For portable applications -NaFeO2 (derived from the rock-salt type) is preferable because this layered structure provides relatively high specific energy and fast Li-ion diffusion in solid-state and, respectively, high specific power. ... However, specific energy is close to that one for LiFePO4 because of the lower capacity (146 mAh g-1). ...

Еще в разделе: (Показать все результаты (>5) - www.elch.chem.msu.ru/ )

• Molecular aspects of solid state and interfacial electrochemistry

... Поиск по МГУ | ... Валдис Пельш снимает документальный фильм о Московском государственном университете имени М.В. Ломоносова . Валдис Пельш снимает документальный фильм о главном, одном из старейших и крупнейших классических университетов России - Московском государственном университете имени М.В. Ломоносова. ... Валдис Пельш снимает документальный фильм о Московском государственном университете имени М.В. Ломоносова с помощью краудфандинга, сообщается в пресс-релизе платформы Planeta.ru. ...

Еще в разделе: (Показать все результаты (>17) - www.msunews.ru/ )

• MsuNews.Ru | Анонсы и объявления | Открытие выставки 'Греческая словесность в

Главная Международные связи Иностранным студентам/ Incoming students . ... Semester Dates for International Students: . ... In case of institutional agreement on international student exchange the program is free of charge. ... All students should come to Russia by Moscow State University invitation. ... Students enter Russia with a single-entry visa. ... Exams/Passes . ... Pass . ...

Еще в разделе: (Показать все результаты (>36) - www.mgubs.ru/ )

• Высшая школа бизнеса МГУ им. Ломоносова

... However, derivation of its main equations from the free energy of a superconductor was only briefly described in the original paper [3], and some basic points of this procedure are still not completely understood. ... What is the sense of the free energy variation with respect to the vector potential of the magnetic field? ... Indeed, in practical calculations the Ginzburg­Landau equations are often used in combination with the Ginzburg­Landau free energy of the superconductor. ...

Еще в разделе: (Показать все результаты (>4) - lizard.phys.msu.su/ )

Moscow Astronomical Plate Archives: . Contents, Digitization, Current and Possible Applications . ... We describe the astronomical plate archives in Moscow and Zvenigorod and the existing digitization projects. ... 2 The Plate Archive of the Sternberg Institute . The contents of the most important Moscow astronomical plate archive, that of the Sternberg Astronomical Institute, was briefly presented in Shugarov et al. [1] in 1999. ... THE MOSCOW PLATE COLLECTION (STERNBERG INSTITUTE) . ...

Еще в разделе: (Показать все результаты (>10) - www.sai.msu.ru/ )

Application of the V--Ray Technology for Optimization of the TRFD and FLO52 Perfect Club Benchmarks to CRAY Y--MP and CRAY T3D Supercomputers Alexander S. Antonov, Vladimir V. Voevodin Moscow State University, Russia e­mail: voevodin@vvv.srcc.msu.su Abstract The paper shows an application of the so­called V­ Ray Technology for optimizing the TRFD and FLO52 Perfect Club Benchmarks to CRAY Y--MP and CRAY T3D supercomputers. ... Results for CRAY Y­MP supercomputers. al structure of the program. ...

Еще в разделе: (Показать все результаты (>2) - asa.guru.ru/ )

Currently available grants . Exchanges and Training Programs for the NIS . ... The U.S. Department of State's Bureau of Educational and Cultural Affairs (ECA), Office of Citizen Exchanges, is offering a grant opportunity for U.S. organizations to conduct exchanges and training programs in collaboration with partner organizations for the New Independent States. ... Funded by the U.S. Department of State, Program for Research and Training on Eastern Europe and the Newly Independent States. ...

Еще в разделе: (Показать все результаты (>5) - suny.msu.ru/ )

• Center on Russia and the United States :: SUNY Professional Fellows Program

... РАБОТА В СЕТИ ИНТЕРНЕТ И ПОИСK . ... При работе в сети Интернет часто возникает необходимость переписать фрагменты открытой страницы на диски компьютера. ... Для того, чтобы посмотреть исходный код загруженной страницы достаточно щелкнуть правой кнопкой мыши на пустом месте документа. При этом на экране появиться меню, в котором надо выбрать строчку "вид источника" (View Source), щелкнув на ней левой кнопкой мыши. ... Оно содержит HTML-текст загруженной страницы. ...

Еще в разделе: (Показать все результаты (>15) - heritage.sai.msu.ru/ )

• А.В.Засов. Задача 13: Определение физических параметров газа в ядре

ISTITUTO NAZIONALE DI FISICA NUCLEARE Sezione di Genova INFN/TC-08/02 23 June 2008 STUDY OF THE RESPONSE OF THE NEMO-KM3 DETECTOR INSTRUMENTED WITH DIRECTION-SENSITIVE OPTICAL MODULE M. Anghinolfi1 , M. Bersani1 , K. Fratini1 , V. Kulikovsky2, M. Osipenko1, A. Plotnikov2, E. Shirokov2, M. Taiuti1 , S. Zavatarelli1 ... Physics, Moscow State University, 119899 Moscow, Russia Abstract We studied the performances of the underwater neutrino telescope NEMO-KM3 ...

Еще в разделе: (Показать все результаты (>4) - antares.sinp.msu.ru/ )

• ANTARES в МГУ

... Solver is implemented in CUDA Numerical Simulation of the Ice Moving in Strati ed Fluid PhD Degree Obtained in 2013 By using GPU we are able to perform computations with higher resolution which gives us an opportunity to study the interaction between sea ice and ocean in greater details Evgeny Mortikov, MSU Research Computing Center , researcher, evgeny.mortikov@gmail.com The project aims at determining the relevance of ocean strati cation for ...

Еще в разделе: (Показать все результаты (>11) - hpc.msu.ru/ )

• APPLICATIONS: Geology | Moscow University Supercomputing Center

INVOLUTION DIFFEOMORPHIC OF MANIFOLDS TO REAL WITH A SET PROJECTIVE OF FIXED POINTS SPACE UDC 517.83 A. S. Mishchenko It is proved that if, on a manifold with an involution, the subset of fixed points is diffeomorphic to an even-dimensional real projective space, then the manifold is bordant to the complex projective space in the class of nonoriented bordisms. ... For each manifold Mn, there is a manifold with involution N 2n such that Mn is its set of fixed points. ...

Еще в разделе: (Показать все результаты (>69) - higeom.math.msu.su/ )

• http://higeom.math.msu.su/~asmish/Lichnaja-2010/Version2010-11-20/Trudy/Publications/2008/Solovyev-obituary-03-03.pdf
• http://higeom.math.msu.su/people/taras/talks/2011osaka-talk.pdf
• http://higeom.math.msu.su/people/taras/mypapers/keldysh100en.pdf

About SPAW Editor . ... As of final version 1.0 of the control you'll need to rename the file spaw_control.default.config.php in config sub-directory to spaw_control.config.php when installing control for the first time. ... All of the SPAW Editor configuration options are located in the config/spaw_control.config.php file. ... This file will be included in img_library.php (Image library dialog script). $request_uri variable will be set to the URL of the page where SPAW Editor instance resides. ...

Еще в разделе: (Показать все результаты (>4) - textbook.sinp.msu.ru/ )

MSU . ... Every year since 2004, the MSU Science Park has conducted an educational program and an innovation project competition called Success Formula (www.successformula.ru). ... In collaboration with the Center of Technology Transfer at Moscow State University and the Chair of Innovation Economics, MSU Science park offers a wide range of educational programs like Success Formula as well as infrastructure projects geared to the incubation of new technology companies on the Moscow University site. ...

199. http://miles.sinp.msu.ru/files/Instr&Exp_Tech_Engl.pdf

200. http://dfgm.math.msu.su/files/papers-sym/0503389v1.pdf