Электронная библиотека Попечительского совета . ... Hoffmann J. - Utilizing Problem Structure in Planning . ... Название: Utilizing Problem Structure in Planning . ... After giving a general introduction to AI planning, the book describes and carefully evaluates the algorithmic techniques used in fast-forward planning systems (FF), demonstrating their excellent performance in many wellknown benchmark domains. ... Электронная библиотека попечительского совета мехмата МГУ , 2004-2016 . ...

Еще в разделе: (Показать все результаты (>13128) - lib.mexmat.ru/ )

... help . ... 2 import subprocess . 3 import os . 4 import shlex . 5 import optparse . ... add_option ( '-n' , '--size' , type = int , help = 'Pool size' ) . ... add_option ( '-c' , '--cmd' , . 10 help = 'Command template. ... 12 options , args = p . ... 14 spawned = 0 . ... 16 if spawned > options . size : . ... 19 cmd = shlex . split ( options . cmd . ... Popen ( cmd ) . ...

Еще в разделе: (Показать все результаты (>27759) - kodomo.fbb.msu.ru/ )

• allpy: 835efa2a8c71 utils/pool
• allpy: d137df18a8bf utils/freqs.py
• allpy: utils/pool diff

. Name . Last Modified . Size . Type . Parent Directory / . - . Directory . ChangeLog . 2016-Mar-20 18:14:28 . 3.9K . application/octet-stream . ChangeLog-2015 . 2015-Nov-09 07:11:44 . 0.9K . application/octet-stream . Data-Structure-Util-0.150.0.ebuild . 2016-Mar-20 15:23:27 . 0.3K . text/plain . Manifest . 2016-Mar-20 18:14:28 . 1.8K . application/octet-stream . metadata.xml . 2016-Jan-25 02:06:09 . 0.2K . text/xml . lighttpd/1.4.35

Еще в разделе: (Показать все результаты (>25878) - mirror.msu.net/ )

Next: msgtool: An interactive message Up: 6.4.2 Message Queues Previous: SYSTEM CALL: msgsnd() . ... Now, we will turn the discussion to directly manipulating the internal structures associated with a given message queue. To perform control operations on a message queue, you use the msgctl() system call. ... Sets the value of the ipc_perm member of the msqid_ds structure for a queue. ... We retrieve a current copy of the internal data structure by a quick call to our get_queue_ds wrapper function. ...

Еще в разделе: (Показать все результаты (>428) - itpm.msu.su/ )

• Kernel semid_ds structure
• Kernel msg structure
• SYSTEM CALL: semop()

This home page belongs to small group of scientists working at . Sternberg Astronomical Institute which is a part of Moscow State University . ... Электронная библиотека научно-технической и художественной литературы (доступна только из ГАИШ) . ... Local staff . Dr. Edward Kononovich (konon -at- sai.msu.ru), Associate Professor . ... Dr. Sergey Ayukov (asv -at- sai.msu.ru), Research Fellow, Webmaster of the group . ... Joint seminar of Solar Studies Structure Group and Solar Photometry Group . ...

Еще в разделе: (Показать все результаты (>4410) - crydee.sai.msu.ru/ )

... Package . Class . ... Deprecated . Index . Help . PREV NEXT . FRAMES NO FRAMES All Classes . Package Hierarchies: . All Packages . class java.lang.Object . class utils. ... class java.lang.Throwable (implements java.io.Serializable) . class java.lang.Exception . ... interface utils. ...

Еще в разделе: (Показать все результаты (>87) - angel.cs.msu.su/ )

• : ucar.util Class Hierarchy
• utils
• Class Hierarchy

... Utilization of fluorescent chimeras for investigation of heterooligomeric complexes formed by human small heat shock proteins. ... Fluorescent chimeras were used for investigation of heterooligomeric complexes formed by different small heat shock proteins (sHsp) and for analysis of their subunit exchange. ... Fluorescent proteins inside heterooligomeric complexes formed by HspB1/HspB6 and HspB5/HspB6 chimeras are closely located, making possible effective fluorescence resonance energy transfer (FRET...

Еще в разделе: (Показать все результаты (>70) - biochem.bio.msu.ru/ )

• Measurement of B-type natriuretic peptide by two assays utilizing antibodies
• Molecular structure and dynamics of the dimeric human small heat shock protein

Lomonosov Moscow State University was established in 1755 . ... Lomonosov Moscow State University Diary . ... MSU Web Sites . ... Faculties . Institutes . Centres . ... Study and Research . ... Lomonosov Moscow State University offers a world class education to everyone with the ability to benefit. ... Department for Academic Policy and Degree Programs Management . Department for Research Policy and Research Management . ... Department of Development Program at Moscow University . ...

Еще в разделе: (Показать все результаты (>199) - www.msu.ru/ )

• General Information
• Lomonosov Moscow State University
• Faculty of Biology

... Dynamic Host Configuration Protocol · · - : ­ DHCP (UDP:67) ­ ( , IP , , DNS-) ­ DHCP (UDP:68) ­ DHCP netstat -pan | ... CLI_IP ping · ping ­ (Echo Request) ­ (Echo Reply) ICMP · . ... Domain Name System ( DNS ) · · DNS - · (, IP (A, AAAA)) · DNS UDP :53 DNS ip domain-name DNS - server : nslookup domain-name [ DNSserver ] dig [@ DNS - server ] domain name domain-name ip arpa: ya.ru (93.158.134.3) dig 3.134.158.93.in-addr.arpa dig 8.8.8.8.in-addr.arpa iperf iperf e2e iperf udp ...

Еще в разделе: (Показать все результаты (>9) - lvk.cs.msu.su/ )

... Alignment Sequence . Include picture . No Picture Only Structure Structure and BP numbers Structure and Stem Energy Full Picture . Sequence name . Alignment OR sequence (without name). The usage of Alignment is strongly recommended. Alignment example: . ... ANMF CGCGGGGTAGAGCAGCCTGGTAGCTCGTCGGGCTCATA AQTRNF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAA BGTRF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAT ANMF ATCCTCTCCCCGCC---- AQTRNF ATCCGCCTCCCGGCACCA BGTRF ATCCGCCTCCCGGCACCA . ...

Еще в разделе: (Показать все результаты (>213) - www.genebee.msu.ru/ )

• Screening pattern or alignmemt against PROTEIN databank

... Экологический Форум - Фундаментальная Экология : Предложения и замечания по сайту . Тема: whilst utilizing cheekbones coupled with . ... If you are looking for your pair of Oakley sunglasses Sun shades Ray-Ban design and style and after that the most beneficial location to invest in on-line. ... Переход на форум -- Выберите форум -- О сайте "Фундаментальная экология" - Предложения и замечания по сайту Научные семинары - Научные семинары . Вы не можете публиковать новые темы в этом форуме . ...

Еще в разделе: (Показать все результаты (>4457) - www.sevin.ru/ )

• Экологический Форум - Фундаментальная Экология: while utilizing cheekbones
• Экологический Форум - Фундаментальная Экология: though utilizing cheekbones
• Экологический Форум - Фундаментальная Экология: when utilizing cheekbones

... Prof, head of the laboratory of x-ray diffraction and crystal chemistry Home address: Russia, 115470, Prosp. ... 1964-1969 a student of Geological faculty MSU, department of crystallography 1969-1973 a post graduate student (scientific advisor academician N.V.Belov) 1974 Ph.D., speciality 'Crystallography and Crystalphysica', title of Ph.D. Thesis 'Crystal structures of (Na,Cd)-germanates' 1994 D.Sc., speciality 'Physical chemistry', title of D.Sc. ... E.L.Belokoneva, L.I.Leonjuk, V.S.Urusov. ...

Еще в разделе: (Показать все результаты (>53) - cryst.geol.msu.ru/ )

... About lab . ... Online Journal "Computer graphics and multimedia" (in russian) . ... Ensemble Decomposition Learning for Optimal Utilization of Implicitly Encoded Knowledge in Biomedical Applications . ...

Еще в разделе: (Показать все результаты (>130) - graphics.cs.msu.ru/ )

• Reconstruction of structure and texture of city building facades. | Graphics
• GML LidarK Library | Graphics and Media Lab
• Reconstruction of structure and texture of city building facades. | Лаборатория

... Melnikov, V.A. Smirnov . ... For many years, the authors' activities in the field of radical photochemistry have been stimulated by pioneering works of V.V. Voevodskii, N.M. Emanuel, A.L. Buchachenko, V.K. Milinchuk, V.D. Pokhodenko, J. Willard, K. Tsuji, and many others. ... ABSORPTION AND EMISSION PROPERTIES OF ORGANIC RADICALS AND BIRADICALS . ... Intennolecular Quenching in Exchange Complex . ... Quenching of excited radicals. ... Poly(vinyl acetate), poly(vinyl alcohol), and poly(vinyl acetals)...

Еще в разделе: (Показать все результаты (>1021) - chem.msu.ru/ )

• Features of the real structure of doped PbTe crystals
• PC Crystal Chemistry Analysis of Organic Crystal Structures
• Modeling of Supramolecular Ordering in Molecular Liquids: Structure,

... История кафедры . ... младших курсов . ... Уважаемые студенты 1-го, 2-го и 3-го курсов! ... Семинар кафедры проходит по пятницам в 15.20 в комн. ... а также на стендах кафедры на 2-м и 4-м этажах. Информацию о более ранних событиях см. в разделе "Жизнь кафедры" . ... 119991, Москва, Ленинские горы, д.1, стр.2, МГУ имени М.В.Ломоносова, физический факультет, кафедра фотоники и физики микроволн . ...

Еще в разделе: (Показать все результаты (>2) - photonics.phys.msu.ru/ )

AstroNet is the name of network of Sternberg Astronomical Institute , Moscow University . Currently, we have full Internet connectivity at 115 Kbps via leased line to our Internet Provider The Radio-MSU Network since 1993. ... phone: +7 (095) 939-1683, +7 (095) 939-2383 . fax: +7 (095) 939-2383 . Evgeny Rodichev - system administrator of AstroNet, Internet group , er@sai.msu.su , . phone: +7 (095) 939-2383 . ... 13, Sternberg Astronomical Institute - Moscow University, Moscow, Russia. ...

Еще в разделе: (Показать все результаты (>1888) - www.sai.msu.su/ )

• SAL- Other Scientific Fields - Misc - TELPACK
• Line Disciplines and Streams Modules
• SAL- Programming - Languages Compilers - ADAMO

... Previous message: [RU-NGI] Проблемы на региональном Nagios с модулями lcg_util для Python? ... Ryabinkin wrote: Обозревая произошедшее за ночь, я увидел, что у многих сайтов сегодня с 4 до 6 ночи были проблемы с тестом org.sam.SRM-All : {{{ [ 09-12-2012 05:19:52] SERVICE ALERT: cluster.pnpi.nw.ru; org.sam.SRM-All -/ops/Role=lcgadmin; UNKNOWN ;HARD;4; UNKNOWN : Error loading modules : No module named lcg_util [ ... More information about the RU-NGI mailing list . ...

Еще в разделе: (Показать все результаты (>989) - theory.sinp.msu.ru/ )

• MRS structure functions
• General structure
• Structure of LanHEP input file

... Sur le CEI . ... Informations utiles . ... Bulletin (Vestnik) (en russe) . FAQS (en russe) . ... L?Universit? de l??tat de Moscou M. V. Lomonosov . ... Moscou (en russe Москва, Moskva, API [m?sk va]) est la capitale russe et la plus grande ville de Russie et d Europe. Travers e par la rivi re Moskova, situ e dans la partie europ enne de la Russie et administrativement dans le district f d ral central, Moscou est la ville la plus peupl e d Europe avec 12,6 millions d habitants en 2007. ...

Еще в разделе: (Показать все результаты (>265) - www.cie.ru/ )

• S?minaires options d??t? :: Les programmes d?enseignement :: CEI
• Structure :: About Center for International Education :: CIE
• Contacts :: CEI

... We used this genomic data and a comparative genomics approach to infer carbohydrate utilization pathways and their transcription regulation in these UCC bacteria. ... The reconstructed catabolic pathways were partially validated by phenotypic analyses of UCC community members that were isolated in a pure culture, and their abilities to utilize an individual sugar as a sole source of carbon and energy was further tested. ...

Еще в разделе: (Показать все результаты (>202) - mccmb.belozersky.msu.ru/ )

• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/153.pdf
• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/91.pdf
• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/175.pdf

... wLake 1.7 . wLake is a tool which allows to identify clusters of a structural water molecules in given superimposed 3D structures. Put your coordinates in PDB format into the text area. Select a distance threshold. Two water molecules from different structures will be concidered as located in the same space point if the distance between centers of oxygen atoms is less than this threshold. ... EACH STRUCTURE INCLUDING ITS WATER MOLECULES MUST BE PRESENTED AS SEPARATE MODEL: EXAMPLE. ...

Еще в разделе: (Показать все результаты (>12) - mouse.belozersky.msu.ru/ )

• Geometrical core