SAI 175 anniversary . ... Moscow University . Search for in SAI Moscow University Search for in Russian astronomical resources . ... SAI Astronomical Databases . ... Browse SAI Software archive(ftp.sai.msu.su) . ASTRONET.RU - Russian Astronomical Network (available in translit also) . ... SAI Supernovae Research Group . ... Department of the Galaxy and Variable Stars (in Russian) . Sternberg Astronomical Institute Seminars . ... All-Russian Astronomical Olympiad (in Russian) . ...

Еще в разделе: (Показать все результаты (>10389) - www.sai.msu.su/ )

• Full Text Search in databases

... Staff . ... Doctor of Physics and Mathematics, Professor Head of the Laboratory of Nonlinear Analysis and the Design of New Types of Vehicles at Udmurt State University . Leading Researcher at Steklov Mathematical Institute RAS . Senior Researcher of the Department of Theoretical Mechanics at Moscow Institute of Physics and Technology . ... Professor of Department of Theoretical Physics at UdSU . ... Researcher of Laboratory of Computer Physics of Department of Theoretical Physics at UdSU . ...

Еще в разделе: (Показать все результаты (>217) - ics.org.ru/ )

• Institute of Computer Sciences - Staff - Borisov Alexey V
• Institute of Computer Sciences - Staff - Erdakova Nadezhda Nikolaevna
• Institute of Computer Sciences - Publications

The Chair of Mathematical Theory of Intelligent Systems and . Laboratory of Problems of Theoretical Cybernetics . ... MaTIS Chair . ... Research . ... Computer Solver . ... development of computer teaching systems . Information Monitoring . creating the systems of information monitoring . Search in Databases . systems of fast search in extensive databases . ... The Chair of Mathematical Theory of Intelligent Systems, Laboratory of Problems of Theoretical Cybernetics . ...

Еще в разделе: (Показать все результаты (>162) - www.intsys.msu.ru/ )

• Intelligent Systems :: Research :: Computer Teacher
• Intelligent Systems :: Research :: Computer Solver
• Intelligent Systems :: Research :: :: Demos

... The approach for estimation of the homology search program sensitivity in nucleotide case was proposed in paper I.Anderson, A.Brass , "Searching DNA databases for similarities to DNA sequences: when is a match significant?" ... Seven sequences were chosen to have length varying from 100 to 1000 bp. ... Each of the 1000 artificially evolved sequences was used as a query for database search with Genebee search, blast-2.0.8 and fasta-3.3 as search engine. ... Sequence length . ... 100 . ... Blast 2.0 ....

Еще в разделе: (Показать все результаты (>278) - www.genebee.msu.ru/ )

• Selected Scientific Journals - Search Engines
• BLAST Basic Overview
• Internet Services

... 32Bits Online: because there's more than one way to compute . New about new versions of computer related stuff . AAA Matilda Web Search . ... Search . ... The Music Database . ... Musicians looking for other musicians (Free Service) . ... The Mac Game Database uses PHP and MySQL . ... Bioinformatics databases at the Montreal Children's Hospital using MySQL . ... DSL providers search with reviews Made with MySQL and Modperl, all pages are generated dynamically out of the MySQL database . ...

Еще в разделе: (Показать все результаты (>366) - itpm.msu.su/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>33) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search
• Nhunt

... This course focuses on main characteristics of the ?life? of academic information (its development and diffusion), and on basic algorithms of data retrieval. ... This course consists of four interrelated areas: theoretical introduction (Internetics and information theory), and practical units including the three pillars of information retrieval services: factual, bibliographic and documentary search. ... Factual search. ... Internet-heuristics strategies: summarizing information retrieval skills . ...

Еще в разделе: (Показать все результаты (>287) - hist.msu.ru/ )

• Laboratory for the Study of Byzantium and the Black Sea Region

Laboratory of Informatics . Head of Laboratory E.S.Polischuk, senior researcher, DSc . ... research guidance of a four year student's project in the Faculty of Geography (N.M. Chernavskaya, DSc) . ... Grant of RFBF (Russian Foundation for Basic Research) 01-03-00332, the head of the project prof. R.B.Rybakov, Institute of Orientalistic (Russian Academy of Science), N. M. Chernavskaya - performer . ... N.M.Chernavskaya, DSc, senior researcher, T.B.Pleskacheva., DSc, senior researcher. ...

Еще в разделе: (Показать все результаты (>128) - srcc.msu.ru/ )

• Laboratory of Systems for Automated Image Processing

You can search database for submitted information. ... Character * specifies arbitrary character sequence (eg. '*n' will result: John, Martin etc.) Character * is placed at end of line automatically ('Mar*' = 'Mar' will result: Martin, Martina etc.) Blank form will result ALL database records. ... Family name: . ... Topic: . ... Seismo-tectonics of Tsunami 3. Numerical and Analytical Models of Local Tsunami Behavior 4. ... Recent Local Tsunamis 8. ... Information . ... Database search . ...

Еще в разделе: (Показать все результаты (>31) - seac47-2.phys.msu.ru/ )

Online Services | ... Research) IPN(Institute Physics Nuclear, Paris) ISN(Institute Science Nuclear, Grenoble) JINR(Joint Institute Nuclear Research) JUL-Spez(Institute fur Kernphysik) JYFL(University Jyvaskyla, Finland) LA(Los Alamos Science Laboratory) LBL(Lawrence Berkeley Laboratory) NEANDC(Nuclear Data Committee) ORNL(Oak Ridge National Laboratory) UTTAC(University Tsukuba Center) ZFK(Zentralinstitut fur Kernforschung) **************************************************** Other Code . ... Code: . ...

Еще в разделе: (Показать все результаты (>4933) - cdfe.sinp.msu.ru/ )

• CDFE => Online Services
• CDFE => Online Services => Nucleus Ground State Parameters
• CDFE provides the major photonuclear databases. Online Services.

... Moscow University Search Engine . AstroSearch - search astronomical sites . Open FTS search engine . MailWare (PostgreSQL mailing list archive) Our commercial interests . ... This full text search engine by XWare team provides the document search over all Moscow State University Web sites. ... OpenFTS (Open source Full Text Search) is an advanced PostgreSQL-based search engine that provides online indexing of data and relevance ranking for database searching. ... 2001-116 XWare Team. ...

Еще в разделе: (Показать все результаты (>9379) - www.astronet.ru/ )

• How to Search for Aliens
• Астронет > How to Search for Aliens
• Астронет > Форумы > Астрономия и Интернет > Searching: photometric atlas of the

Электронная библиотека Попечительского совета . ... Calishain T. - Web Search Garage . ... Название: Web Search Garage . Автор: Calishain T. Аннотация: . Writing in a reader-friendly style, Calishain, editor of a weekly newsletter on Internet searching, explains what search engines are for, how to use them, and what tools to use with them to make researching easier. ... types of" searches . ... address searches . ... Электронная библиотека попечительского совета мехмата МГУ , 2004-2016 . ...

Еще в разделе: (Показать все результаты (>20929) - lib.mexmat.ru/ )

• Поиск книг, содержащих Binary search :: Электронная библиотека попечительского
• Papadopoulos A.N., Manolopoulos Y. - Nearest Neighbor Search: A Database
• Tabak J. - Numbers: Computers, Philosophers, and the Search for Meaning ::

... 119991, Moscow, GSP-1, Leninskiye Gory, MSU, 2nd Educational Building, CMC Faculty, rooms 590, 591 (Head of the laboratory), 62 . The Laboratory was established in 2001 to provide teaching and research in mathematical foundations of cryptography, cryptoanalysis, information and software security. ... The Laboratory of Mathematical Problems of Computer Security is performing a thorough research on mathematical problems in cryptoanalysis, information security, and program verification. ...

Еще в разделе: (Показать все результаты (>266) - en.cs.msu.ru/ )

• Laboratory of Computer Engineering | CMC MSU
• Open Laboratory of Information Technologies | CMC MSU
• Laboratory of Computational Practice and Information Systems | CMC MSU

... Research . ... 1972 – current: Moscow State University . ... In 1989 she took her doctor's degree in linguistics (kandidat filologicheskikh nauk) at Lomonosov Moscow State University for the thesis "Computer data bases of the Selkup language: creation and use in linguistic research (Mashinnyi fond selkupskogo yazyka: sozdaniye i ispol’zovaniye v konkretnykh lingvisticheskikh issledovaniyakh)”. ... Documentation of and research into endangered languages presupposes linguistic fieldwork . ...

Еще в разделе: (Показать все результаты (>66) - lcl.srcc.msu.ru/ )

... IPI-1D is a set of programs for processing and interpretation of VES data within the framework of horizontally layered models . ... Except programs already listed above, our specialists developed some programs for modeling, studying, visualization and interpretation of resistivity data in anisotropic media (anisotropic halfspace, horizontally layered media with anisotropic basement and vertical contact of two anisotropic media). ...

Еще в разделе: (Показать все результаты (>48) - geophys.geol.msu.ru/ )

• Near-surface electrical prospecting laboratory at Moscow University

... Faculty of Physics . ... Online journals . ... Access to the E-library is open from any computer in the intranet of the Faculty connected to the Internet. ... URL link: http://www.iop.org/EJ/ These journals can be accessed on-line from any computer in the intranet connected to the Internet. ... URL link: http://www.elsevier.com/wps/find/journal_browse.cws_home/P12?pseudotype= =Title 1Code=P12 =A These journals can be accessed on-line from any computer in the intranet connected to the Internet. ...

Еще в разделе: (Показать все результаты (>11) - www.phys.msu.ru/ )

• Faculty Staff

Swiss-Prot, Trembl, UniProt on the ExPASy server (Expert Protein Analysis System) . UniProt on the EBI server (European Bioinformatics Institute) . SRS Sequence Retrieval System: Access to Swiss-Prot, TrEMBL and other databases using the Sequence Retrieval System . PubMed (BioMedical Science Litterature Searching System), TaxBrowser (Encyclopedia of Systematics) on the NCBI server (National Center for Biotechnology Information) . ... GeneMark- Program for Statistical Prediction of Genes . ...

Еще в разделе: (Показать все результаты (>9837) - kodomo.cmm.msu.ru/ )

• http://kodomo.cmm.msu.ru/~plazmoliz/Term3/sup/pyr_D.txt
• http://kodomo.cmm.msu.ru/~plazmoliz/Term3/sup/all_blastn.txt
• http://kodomo.cmm.msu.ru/~plazmoliz/Term3/sup/cds_result.txt

... MSU Web Sites . ... Faculties . Institutes . ... Main Building: . University administration (Sectorљ"А", 9љfloor) љљ . Faculty of geography (Sectorљ"А", 17-21љfloors) љљ . ... Building of the faculty of physics: . ... Building of the faculty of chemistry: . ... Biology and soil building . ... Building of the faculty of sociology: . ... Building of the faculty of economics: . ... MSU confucius institute (5љfloor) . ... MSU main library building (27, Lomonosovsky prospect): . ...

Еще в разделе: (Показать все результаты (>214) - www.msu.ru/ )

• Lomonosov Moscow State University
• Institute of Asian and African Studies
• MSU institutes

Name: Position: Institutional a ffiliat ion : E-mail: Web: Phone: Anton S. Konushin Researcher Lomonosov Moscow State Unive rs ity, Faculty of Computational Mathematics and Cybernetic, Graphics Med ia laboratory ktosh@ graphics .cs.msu.ru http:// graphics .cs.msu.ru/en/people/staff/akonushin +7(495)9390190 Education M.S. Lomonosov Moscow State Univers ity 2002 Applied mathematics and Computer vis ion collaborat ive research in Russia". ... Content-based search in la rge video archives». ...

Еще в разделе: (Показать все результаты (>906) - graphics.cs.msu.ru/ )

• Congratulations to Olga Senyukova and Mikhail Erofeev who have received MSU

News . ... International Symposium "Information Systems and Web-portals on Biodiversity of Species Ecosystems" . ... We invite you to take part in the International Symposium 'Information Systems and WEB-portals on Biodiversity of Species Ecosystems' which will be held in Borok, Yaroslavl province, Russia, November 28 th to 1 st December, 2006. ... Pavlov D.S. - Director of Severtsov Institute of Ecology Evolution RAS, Moscow . ... A.N. Severtsov Institute of Ecology and Evolution (IPEE RAS) ...

Еще в разделе: (Показать все результаты (>4827) - www.sevin.ru/ )

• A.N. Severtsov Institute of Ecology and Evolution (IPEE RAS): Site News: Site
• A.N. Severtsov Institute of Ecology and Evolution (IPEE RAS): News: News: II
• A.N. Severtsov Institute of Ecology and Evolution (IPEE RAS): News