Электронная библиотека Попечительского совета . ... Searcid M. - Metric Spaces . ... Название: Metric Spaces . ... The abstract concepts of metric spaces are often perceived as difficult. ... Attained, bound criterion 206 . ... Bounded metric space 104 . ... Compact metric space 148 . ... Complete metric space 65 . ... Connected metric space 192 . ... Discrete metric space 60 . ... Extension of metric space 12-13 . ... Электронная библиотека попечительского совета мехмата МГУ , 2004-2016 . ...

Еще в разделе: (Показать все результаты (>16949) - lib.mexmat.ru/ )

• Seebach J.A., Steen L.A. - Counterexamples in Topology :: Электронная
• Morris S.A. - Topology without tears :: Электронная библиотека попечительского
• Kreyszig E. - Introductory functional analysis with applications :: Электронная

... Length = 194692 Score = 28.2 bits (14), Expect = 1.0 Identities = 14/14 (100%) Strand = Plus / Plus Query: 14 gggattcgaacccc 27 || ... Sbjct: 157615 cccttagcaggggcgcctcttcagcc 157640 Score = 26.3 bits (13), Expect = 4.1 Identities = 13/13 (100%) Strand = Plus / Plus Query: 14 gggattcgaaccc 26 || Sbjct: 158927 gggattcgaaccc 158939 Score = 26.3 bits (13), Expect = 4.1 Identities = 13/13 (100%) Strand = Plus / Plus Query: 14 gggattcgaaccc 26 || ...

Еще в разделе: (Показать все результаты (>4346) - kodomo.cmm.msu.ru/ )

• http://kodomo.cmm.msu.ru/~vanilin/3_1/tRNA_blastn.txt
• статьи о карбоксилэстеразе bioH

Oracle Products . The availablility of Oracle products on Linux will enable users of Linux to deploy enterprise class applications with unparalleled performance at the lowest possible cost. ... Oracle currently has following products available for Linux: . WebDB -- complete and cost-effective solution for building, deploying, and proactively monitoring Web database applications and content-driven Web sites. ... Oracle8 Server -- database management system. ... SAL Home | ... Relational DBMS . ...

Еще в разделе: (Показать все результаты (>2623) - www.sai.msu.su/ )

• SAL- Programming - Languages Compilers - KOPI
• APOD: April 2, 1997 - A Complete Aurora
• FTS Complete Tutorial

... MG1655, complete genome. (927 letters) Database: pm 204 sequences; 2,269,587 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value AE006203 Pasteurella multocida subsp. multocida str. Pm70 sectio.. ... 28 6.5 AE006163 Pasteurella multocida subsp. multocida str. ... Length = 10697 Score = 30.2 bits (15), Expect = 1.6 Identities = 15/15 (100%) Strand = Plus / Plus Query: 193 cgcatgattctgctt 207 || ...

Еще в разделе: (Показать все результаты (>32867) - kodomo.fbb.msu.ru/ )

• allpy: 1e5116ce9d75 allpy/sequence.py
• allpy: 596bdc5897bf allpy/sequence.py
• allpy: 08494fb2c47a lib/sequence.py

... You buy Gucci shades from the company store in the us. There are a total of 7 Gucci stores in different metropolitan areas like Honolulu, Hawaii, Boston. Or if you?re planning an overseas trip to Europe and then sure you visit part of the Gucci retail stores. One can find the brand stores in Florence, . ... These stores offer complete and original associated with designer Gucci Sunglasses and associated accents. ... One should be careful not purchaser gucci Fake. ... 2016 С Днем Победы! ...

Еще в разделе: (Показать все результаты (>313) - elana.sinp.msu.ru/ )

• editor | С Днем Победы!
• Наши ветераны | С Днем Победы!

... Progress . ... RMA calls must have local semantics, except when required for synchronization with other RMA calls. ... On the origin process, an RMA communication may become enabled as soon as the corresponding put, get or accumulate call has executed, or as late as when the ensuing synchronization call is issued. ... This code will deadlock: the wait of process 1 blocks until process 0 calls complete, and the receive of process 0 blocks until process 1 calls send. ... Центры . ...

Еще в разделе: (Показать все результаты (>512) - www.parallel.ru/ )

• Client/Server Examples | PARALLEL.RU - Информационно-аналитический центр по
• Clarification of MPI_FINALIZE | PARALLEL.RU - Информационно-аналитический центр
• Communication Completion | PARALLEL.RU - Информационно-аналитический центр по

... LDAP is the Lightweight Directory Access Protocol, and is a protocol used to access "Directory Servers". ... Search surname entry $sr= ldap _ search ($ds, o=My Company, c=US , sn=S* ); echo Search result is .$sr. p ; echo Number of entires returned is . ldap _count_ entries ($ds,$sr). p ; echo Getting entries ... p ; $info = ldap _ get _ entries ($ds, $sr); ... ldap_get_attributes -- Get attributes from a search result entry . ... ldap_get_entries -- Get all result entries...

Еще в разделе: (Показать все результаты (>583) - oit.cmc.msu.ru/ )

• readline_completion_function
• Parser behavior
• Extension Possibilities

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>30) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

Filename completion is only available if the the environment variables EDITOR and/or VISUAL are set to either emacs , gmacs or vi . For example: EDITOR=emacs . ... To complete a file or directory name with emacs or gmacs set press the ESC key twice. ls -l on<ESC><ESC> line_help . If the filename is not completed enter more characters until the filename can be uniquely identified. ... To complete a file or directory name with vi set press the \ (backward slash) key. ls -l on\ line_help . ...

Еще в разделе: (Показать все результаты (>133) - comet.sai.msu.ru/ )

• Filename completion
• Filename completion with the C shell
• Filename completion with the TC shell

Клуб выпускников МГУ (Московский Государственный Университет) . ... Resvinatrol Complete - на данный момент, первая добавка на рынке, которая использует благоприятное воздействие антиоксиданта ресвератрола, обнаруженного в красном вине, на сердце и замедление процесса старения. Ресвератрол, всего один из сильных антиоксидантов, входящих в состав добавки Resvinatrol Complete. ... Комбинация антиоксидантов Resvinatrol Complete не имеет себе равных на современном рынке антиоксидантной продукции'. ...

Еще в разделе: (Показать все результаты (>357) - www.moscowuniversityclub.ru/ )

• Клуб выпускников МГУ: Обсуждение материала "Таблетки замедляющие процесс

DEVCON for LAN Systems!! ... PSP LAN Systems develops products that provide network operating system services (such as file, print, transaction, security and directory) for multiple operating systems (OS/2, DOS, Windows and AIX). ... PSP LAN Systems has identified an API (or development tools) strategy that provides an application development environment with industry standard APIs for application portability and object frameworks to assist developers with code reuse. ...

Еще в разделе: (Показать все результаты (>3313) - crydee.sai.msu.ru/ )

• http://crydee.sai.msu.ru/ftproot/pub/comp/hardware/wd/mirror/.mirror
• http://crydee.sai.msu.ru/ftproot/pub/rec/music/lyrics/cs-uwp/p/prince/disclaimer