Документ взят из кэша поисковой машины. Адрес оригинального документа : http://kodomo.cmm.msu.ru/~kut/term3/files/bnresult.txt
Дата изменения: Tue Oct 3 00:25:34 2006
Дата индексирования: Tue Oct 2 17:03:07 2012
Кодировка:

BLASTN 2.2.10 [Oct-19-2004]

Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.

Query= U00096 U00096.2 Escherichia coli K12 MG1655, complete genome.
(77 letters)

Database: bs
1 sequences; 4,214,630 total letters

Searching.done

Score E
Sequences producing significant alignments: (bits) Value

AL009126_GR|AL009126_GR Bacillus subtilis (strain 168) chromosom... 44 1e-05

>AL009126_GR|AL009126_GR Bacillus subtilis (strain 168) chromosome,
complete sequence.
Length = 4214630

Score = 44.1 bits (22), Expect = 1e-05
Identities = 22/22 (100%)
Strand = Plus / Plus

Query: 46 ggtcggtggttcgagtccactc 67
||||||||||||||||||||||
Sbjct: 31975 ggtcggtggttcgagtccactc 31996

Score = 44.1 bits (22), Expect = 1e-05
Identities = 22/22 (100%)
Strand = Plus / Plus

Query: 46 ggtcggtggttcgagtccactc 67
||||||||||||||||||||||
Sbjct: 11507 ggtcggtggttcgagtccactc 11528

Score = 40.1 bits (20), Expect = 2e-04
Identities = 20/20 (100%)
Strand = Plus / Minus

Query: 8 tagctcagttggttagagca 27
||||||||||||||||||||
Sbjct: 3171908 tagctcagttggttagagca 3171889

Score = 38.2 bits (19), Expect = 9e-04
Identities = 34/39 (87%)
Strand = Plus / Minus

Query: 21 tagagcaccaccttgacatggtgggggtcggtggttcga 59
|||| |||||||||| || ||||||||||| |||||||
Sbjct: 3172427 tagaacaccaccttgccaaggtgggggtcgcgggttcga 3172389

Score = 38.2 bits (19), Expect = 9e-04
Identities = 34/39 (87%)
Strand = Plus / Plus

Query: 21 tagagcaccaccttgacatggtgggggtcggtggttcga 59
|||| |||||||||| || ||||||||||| |||||||
Sbjct: 952053 tagaacaccaccttgccaaggtgggggtcgcgggttcga 952091

Score = 38.2 bits (19), Expect = 9e-04
Identities = 34/39 (87%)
Strand = Plus / Plus

Query: 21 tagagcaccaccttgacatggtgggggtcggtggttcga 59
|||| |||||||||| || ||||||||||| |||||||
Sbjct: 165976 tagaacaccaccttgccaaggtgggggtcgcgggttcga 166014

Score = 38.2 bits (19), Expect = 9e-04
Identities = 34/39 (87%)
Strand = Plus / Plus

Query: 21 tagagcaccaccttgacatggtgggggtcggtggttcga 59
|||| |||||||||| || ||||||||||| |||||||
Sbjct: 95787 tagaacaccaccttgccaaggtgggggtcgcgggttcga 95825

Score = 34.2 bits (17), Expect = 0.014
Identities = 20/21 (95%)
Strand = Plus / Minus

Query: 6 cgtagctcagttggttagagc 26
|||||||||||||| ||||||
Sbjct: 3544989 cgtagctcagttggatagagc 3544969

Score = 30.2 bits (15), Expect = 0.21
Identities = 18/19 (94%)
Strand = Plus / Minus

Query: 46 ggtcggtggttcgagtcca 64
||||| |||||||||||||
Sbjct: 3171233 ggtcgatggttcgagtcca 3171215

Score = 28.2 bits (14), Expect = 0.83
Identities = 17/18 (94%)
Strand = Plus / Minus

Query: 7 gtagctcagttggttaga 24
|||| |||||||||||||
Sbjct: 4153988 gtagttcagttggttaga 4153971

Score = 28.2 bits (14), Expect = 0.83
Identities = 14/14 (100%)
Strand = Plus / Minus

Query: 7 gtagctcagttggt 20
||||||||||||||
Sbjct: 4153876 gtagctcagttggt 4153863

Score = 28.2 bits (14), Expect = 0.83
Identities = 17/18 (94%)
Strand = Plus / Minus

Query: 7 gtagctcagttggttaga 24
|||| |||||||||||||
Sbjct: 3171629 gtagttcagttggttaga 3171612

Score = 28.2 bits (14), Expect = 0.83
Identities = 14/14 (100%)
Strand = Plus / Minus

Query: 7 gtagctcagttggt 20
||||||||||||||
Sbjct: 3171540 gtagctcagttggt 3171527

Score = 28.2 bits (14), Expect = 0.83
Identities = 14/14 (100%)
Strand = Plus / Plus

Query: 7 gtagctcagttggt 20
||||||||||||||
Sbjct: 951471 gtagctcagttggt 951484

Score = 28.2 bits (14), Expect = 0.83
Identities = 17/18 (94%)
Strand = Plus / Plus

Query: 7 gtagctcagttggttaga 24
|||| |||||||||||||
Sbjct: 951382 gtagttcagttggttaga 951399

Score = 28.2 bits (14), Expect = 0.83
Identities = 17/18 (94%)
Strand = Plus / Plus

Query: 7 gtagctcagttggttaga 24
|||| |||||||||||||
Sbjct: 639958 gtagttcagttggttaga 639975

Score = 26.3 bits (13), Expect = 3.3
Identities = 13/13 (100%)
Strand = Plus / Minus

Query: 8 tagctcagttggt 20
|||||||||||||
Sbjct: 4154225 tagctcagttggt 4154213

Score = 26.3 bits (13), Expect = 3.3
Identities = 13/13 (100%)
Strand = Plus / Minus

Query: 8 tagctcagttggt 20
|||||||||||||
Sbjct: 3172616 tagctcagttggt 3172604

Score = 26.3 bits (13), Expect = 3.3
Identities = 13/13 (100%)
Strand = Plus / Plus

Query: 26 caccaccttgaca 38
|||||||||||||
Sbjct: 2420069 caccaccttgaca 2420081

Score = 26.3 bits (13), Expect = 3.3
Identities = 13/13 (100%)
Strand = Plus / Minus

Query: 42 tgggggtcggtgg 54
|||||||||||||
Sbjct: 1398788 tgggggtcggtgg 1398776

Score = 26.3 bits (13), Expect = 3.3
Identities = 13/13 (100%)
Strand = Plus / Plus

Query: 31 ccttgacatggtg 43
|||||||||||||
Sbjct: 1177627 ccttgacatggtg 1177639

Score = 26.3 bits (13), Expect = 3.3
Identities = 13/13 (100%)
Strand = Plus / Plus

Query: 8 tagctcagttggt 20
|||||||||||||
Sbjct: 528655 tagctcagttggt 528667

Score = 26.3 bits (13), Expect = 3.3
Identities = 13/13 (100%)
Strand = Plus / Plus

Query: 8 tagctcagttggt 20
|||||||||||||
Sbjct: 95571 tagctcagttggt 95583

Database: bs
Posted date: Oct 3, 2006 1:10 AM
Number of letters in database: 4,214,630
Number of sequences in database: 1

Lambda K H
1.37 0.711 1.31

Gapped
Lambda K H
1.37 0.711 1.31

Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 64
Number of Sequences: 1
Number of extensions: 64
Number of successful extensions: 23
Number of sequences better than 10.0: 1
Number of HSP's better than 10.0 without gapping: 1
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 0
Number of HSP's gapped (non-prelim): 23
length of query: 77
length of database: 4,214,630
effective HSP length: 14
effective length of query: 63
effective length of database: 4,214,616
effective search space: 265520808
effective search space used: 265520808
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 13 (26.3 bits)