Документ взят из кэша поисковой машины. Адрес оригинального документа : http://kodomo.cmm.msu.ru/~christablel/term3/blastn.1fasta Дата изменения: Wed Oct 4 17:32:39 2006 Дата индексирования: Tue Oct 2 13:17:20 2012 Кодировка:

BLASTN 2.2.10 [Oct-19-2004]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.

Query= U00096 U00096.2 Escherichia coli K12 MG1655, complete genome.
(93 letters)

Database: bs
21 sequences; 4,215,470 total letters

Searching.done

Score E
Sequences producing significant alignments: (bits) Value

Z99121 Z99121 Bacillus subtilis complete genome (section 18 of 2... 28 1.0
Z99119 Z99119 Bacillus subtilis complete genome (section 16 of 2... 28 1.0
Z99106 Z99106 Bacillus subtilis complete genome (section 3 of 21... 28 1.0
Z99104 Z99104 Bacillus subtilis complete genome (section 1 of 21... 28 1.0
Z99124 Z99124 Bacillus subtilis complete genome (section 21 of 2... 26 4.1
Z99123 Z99123 Bacillus subtilis complete genome (section 20 of 2... 26 4.1
Z99118 Z99118 Bacillus subtilis complete genome (section 15 of 2... 26 4.1
Z99116 Z99116 Bacillus subtilis complete genome (section 13 of 2... 26 4.1
Z99110 Z99110 Bacillus subtilis complete genome (section 7 of 21... 26 4.1
Z99108 Z99108 Bacillus subtilis complete genome (section 5 of 21... 26 4.1

>Z99121 Z99121 Bacillus subtilis complete genome (section 18 of 21): from
3414339 to 3609030.
Length = 194692

Score = 28.2 bits (14), Expect = 1.0
Identities = 14/14 (100%)
Strand = Plus / Plus


Query: 14 gggattcgaacccc 27
||||||||||||||
Sbjct: 130591 gggattcgaacccc 130604


>Z99119 Z99119 Bacillus subtilis complete genome (section 16 of 21): from
3013458 to 3213379.
Length = 199922

Score = 28.2 bits (14), Expect = 1.0
Identities = 14/14 (100%)
Strand = Plus / Plus


Query: 14 gggattcgaacccc 27
||||||||||||||
Sbjct: 158297 gggattcgaacccc 158310



Score = 28.2 bits (14), Expect = 1.0
Identities = 23/26 (88%)
Strand = Plus / Plus


Query: 52 cccttagcaggggagcgccttcagcc 77
||||||||||||| || ||||||||
Sbjct: 157615 cccttagcaggggcgcctcttcagcc 157640



Score = 26.3 bits (13), Expect = 4.1
Identities = 13/13 (100%)
Strand = Plus / Plus


Query: 14 gggattcgaaccc 26
|||||||||||||
Sbjct: 158927 gggattcgaaccc 158939



Score = 26.3 bits (13), Expect = 4.1
Identities = 13/13 (100%)
Strand = Plus / Plus


Query: 14 gggattcgaaccc 26
|||||||||||||
Sbjct: 157479 gggattcgaaccc 157491


>Z99106 Z99106 Bacillus subtilis complete genome (section 3 of 21): from
415769 to 611680.
Length = 195912

Score = 28.2 bits (14), Expect = 1.0
Identities = 23/26 (88%)
Strand = Plus / Minus


Query: 52 cccttagcaggggagcgccttcagcc 77
||||||||||||| || ||||||||
Sbjct: 112617 cccttagcaggggcgcctcttcagcc 112592



Score = 26.3 bits (13), Expect = 4.1
Identities = 13/13 (100%)
Strand = Plus / Minus


Query: 14 gggattcgaaccc 26
|||||||||||||
Sbjct: 112757 gggattcgaaccc 112745


>Z99104 Z99104 Bacillus subtilis complete genome (section 1 of 21): from
1 to 213080.
Length = 213080

Score = 28.2 bits (14), Expect = 1.0
Identities = 14/14 (100%)
Strand = Plus / Minus


Query: 14 gggattcgaacccc 27
||||||||||||||
Sbjct: 22369 gggattcgaacccc 22356



Score = 26.3 bits (13), Expect = 4.1
Identities = 13/13 (100%)
Strand = Plus / Minus


Query: 14 gggattcgaaccc 26
|||||||||||||
Sbjct: 194255 gggattcgaaccc 194243



Score = 26.3 bits (13), Expect = 4.1
Identities = 13/13 (100%)
Strand = Plus / Minus


Query: 14 gggattcgaaccc 26
|||||||||||||
Sbjct: 166019 gggattcgaaccc 166007



Score = 26.3 bits (13), Expect = 4.1
Identities = 13/13 (100%)
Strand = Plus / Minus


Query: 14 gggattcgaaccc 26
|||||||||||||
Sbjct: 95830 gggattcgaaccc 95818



Score = 26.3 bits (13), Expect = 4.1
Identities = 13/13 (100%)
Strand = Plus / Minus


Query: 14 gggattcgaaccc 26
|||||||||||||
Sbjct: 70326 gggattcgaaccc 70314


>Z99124 Z99124 Bacillus subtilis complete genome (section 21 of 21): from
4010730 to 4214630.
Length = 203901

Score = 26.3 bits (13), Expect = 4.1
Identities = 13/13 (100%)
Strand = Plus / Plus


Query: 14 gggattcgaaccc 26
|||||||||||||
Sbjct: 143357 gggattcgaaccc 143369


>Z99123 Z99123 Bacillus subtilis complete genome (section 20 of 21):
from 3809641 to 4010779.
Length = 201139

Score = 26.3 bits (13), Expect = 4.1
Identities = 13/13 (100%)
Strand = Plus / Minus


Query: 7 tgaggcggggatt 19
|||||||||||||
Sbjct: 78183 tgaggcggggatt 78171


>Z99118 Z99118 Bacillus subtilis complete genome (section 15 of 21): from
2812801 to 3013507.
Length = 200707

Score = 26.3 bits (13), Expect = 4.1
Identities = 13/13 (100%)
Strand = Plus / Plus


Query: 32 gcagcttttgacc 44
|||||||||||||
Sbjct: 133489 gcagcttttgacc 133501



Score = 26.3 bits (13), Expect = 4.1
Identities = 13/13 (100%)
Strand = Plus / Plus


Query: 25 cccggatgcagct 37
|||||||||||||
Sbjct: 113727 cccggatgcagct 113739


>Z99116 Z99116 Bacillus subtilis complete genome (section 13 of 21):
from 2409151 to 2613687.
Length = 204537

Score = 26.3 bits (13), Expect = 4.1
Identities = 13/13 (100%)
Strand = Plus / Plus


Query: 67 cgccttcagcctc 79
|||||||||||||
Sbjct: 68040 cgccttcagcctc 68052



Score = 26.3 bits (13), Expect = 4.1
Identities = 13/13 (100%)
Strand = Plus / Plus


Query: 29 gatgcagcttttg 41
|||||||||||||
Sbjct: 4443 gatgcagcttttg 4455


>Z99110 Z99110 Bacillus subtilis complete genome (section 7 of 21): from
1209742 to 1410982.
Length = 201241

Score = 26.3 bits (13), Expect = 4.1
Identities = 13/13 (100%)
Strand = Plus / Plus


Query: 64 gagcgccttcagc 76
|||||||||||||
Sbjct: 43899 gagcgccttcagc 43911


>Z99108 Z99108 Bacillus subtilis complete genome (section 5 of 21): from
813670 to 1011078.
Length = 197409

Score = 26.3 bits (13), Expect = 4.1
Identities = 13/13 (100%)
Strand = Plus / Minus


Query: 14 gggattcgaaccc 26
|||||||||||||
Sbjct: 138427 gggattcgaaccc 138415



Score = 26.3 bits (13), Expect = 4.1
Identities = 13/13 (100%)
Strand = Plus / Minus


Query: 14 gggattcgaaccc 26
|||||||||||||
Sbjct: 137514 gggattcgaaccc 137502



Score = 26.3 bits (13), Expect = 4.1
Identities = 13/13 (100%)
Strand = Plus / Minus


Query: 14 gggattcgaaccc 26
|||||||||||||
Sbjct: 137405 gggattcgaaccc 137393


Database: bs
Posted date: Oct 4, 2006 5:28 PM
Number of letters in database: 4,215,470
Number of sequences in database: 21

Lambda K H
1.37 0.711 1.31

Gapped
Lambda K H
1.37 0.711 1.31


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 176
Number of Sequences: 21
Number of extensions: 176
Number of successful extensions: 22
Number of sequences better than 10.0: 10
Number of HSP's better than 10.0 without gapping: 10
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 0
Number of HSP's gapped (non-prelim): 22
length of query: 93
length of database: 4,215,470
effective HSP length: 14
effective length of query: 79
effective length of database: 4,215,176
effective search space: 332998904
effective search space used: 332998904
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 13 (26.3 bits)