Документ взят из кэша поисковой машины. Адрес оригинального документа : http://kodomo.cmm.msu.ru/~anuta_al/projects/ap009048-pm Дата изменения: Wed Nov 4 22:25:41 2009 Дата индексирования: Tue Oct 2 12:24:29 2012 Кодировка:

BLASTN 2.2.21 [Jun-14-2009]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.

Query= AP009048 AP009048.1 Escherichia coli str. K12 substr. W3110
DNA, complete genome.
(1830 letters)

Database: pm
204 sequences; 2,269,587 total letters

Searching..................................................done



Score E
Sequences producing significant alignments: (bits) Value

AE006179 Pasteurella multocida subsp. multocida str. Pm70 sectio... 38 0.013
AE006136 Pasteurella multocida subsp. multocida str. Pm70 sectio... 32 0.83
AE006094 Pasteurella multocida subsp. multocida str. Pm70 sectio... 32 0.83
AE006092 Pasteurella multocida subsp. multocida str. Pm70 sectio... 32 0.83
AE006073 Pasteurella multocida subsp. multocida str. Pm70 sectio... 32 0.83
AE006215 Pasteurella multocida subsp. multocida str. Pm70 sectio... 30 3.3
AE006200 Pasteurella multocida subsp. multocida str. Pm70 sectio... 30 3.3
AE006138 Pasteurella multocida subsp. multocida str. Pm70 sectio... 30 3.3
AE006122 Pasteurella multocida subsp. multocida str. Pm70 sectio... 30 3.3
AE006111 Pasteurella multocida subsp. multocida str. Pm70 sectio... 30 3.3
AE006081 Pasteurella multocida subsp. multocida str. Pm70 sectio... 30 3.3
AE006058 Pasteurella multocida subsp. multocida str. Pm70 sectio... 30 3.3
AE006038 Pasteurella multocida subsp. multocida str. Pm70 sectio... 30 3.3

>AE006179 Pasteurella multocida subsp. multocida str. Pm70 section 146
of 204 of the complete genome.
Length = 11375

Score = 38.2 bits (19), Expect = 0.013
Identities = 31/35 (88%)
Strand = Plus / Plus


Query: 214 tcaccgctgatttcgttgatgaaagatcaggtgga 248
||||| ||||| ||||| ||||||||||| |||||
Sbjct: 1593 tcaccactgatctcgttaatgaaagatcaagtgga 1627



Score = 30.2 bits (15), Expect = 3.3
Identities = 21/23 (91%)
Strand = Plus / Plus


Query: 715 ggcattatctactgcaacagccg 737
|||||||||||||| || |||||
Sbjct: 2094 ggcattatctactgtaatagccg 2116


>AE006136 Pasteurella multocida subsp. multocida str. Pm70 section
103 of 204 of the complete genome.
Length = 11061

Score = 32.2 bits (16), Expect = 0.83
Identities = 16/16 (100%)
Strand = Plus / Plus


Query: 431 ccgttgatgaagcgca 446
||||||||||||||||
Sbjct: 866 ccgttgatgaagcgca 881


>AE006094 Pasteurella multocida subsp. multocida str. Pm70 section 61
of 204 of the complete genome.
Length = 11956

Score = 32.2 bits (16), Expect = 0.83
Identities = 16/16 (100%)
Strand = Plus / Minus


Query: 679 ttgatgcgctacgtgc 694
||||||||||||||||
Sbjct: 2797 ttgatgcgctacgtgc 2782


>AE006092 Pasteurella multocida subsp. multocida str. Pm70 section 59 of
204 of the complete genome.
Length = 13170

Score = 32.2 bits (16), Expect = 0.83
Identities = 16/16 (100%)
Strand = Plus / Plus


Query: 1445 tgacgcaaaatattgc 1460
||||||||||||||||
Sbjct: 12800 tgacgcaaaatattgc 12815


>AE006073 Pasteurella multocida subsp. multocida str. Pm70 section 40
of 204 of the complete genome.
Length = 14986

Score = 32.2 bits (16), Expect = 0.83
Identities = 16/16 (100%)
Strand = Plus / Minus


Query: 614 tcagcagttttgaccg 629
||||||||||||||||
Sbjct: 8827 tcagcagttttgaccg 8812


>AE006215 Pasteurella multocida subsp. multocida str. Pm70 section 182
of 204 of the complete genome.
Length = 11975

Score = 30.2 bits (15), Expect = 3.3
Identities = 15/15 (100%)
Strand = Plus / Plus


Query: 810 ggaaaataatgttcg 824
|||||||||||||||
Sbjct: 2971 ggaaaataatgttcg 2985


>AE006200 Pasteurella multocida subsp. multocida str. Pm70 section 167
of 204 of the complete genome.
Length = 9294

Score = 30.2 bits (15), Expect = 3.3
Identities = 15/15 (100%)
Strand = Plus / Minus


Query: 578 tgcgcctgctggggc 592
|||||||||||||||
Sbjct: 7909 tgcgcctgctggggc 7895


>AE006138 Pasteurella multocida subsp. multocida str. Pm70 section 105
of 204 of the complete genome.
Length = 11115

Score = 30.2 bits (15), Expect = 3.3
Identities = 15/15 (100%)
Strand = Plus / Minus


Query: 1007 cgatgctgttttacg 1021
|||||||||||||||
Sbjct: 7018 cgatgctgttttacg 7004


>AE006122 Pasteurella multocida subsp. multocida str. Pm70 section 89 of
204 of the complete genome.
Length = 12428

Score = 30.2 bits (15), Expect = 3.3
Identities = 15/15 (100%)
Strand = Plus / Plus


Query: 1307 tggaagtgattcgtg 1321
|||||||||||||||
Sbjct: 11187 tggaagtgattcgtg 11201


>AE006111 Pasteurella multocida subsp. multocida str. Pm70 section 78
of 204 of the complete genome.
Length = 10062

Score = 30.2 bits (15), Expect = 3.3
Identities = 15/15 (100%)
Strand = Plus / Plus


Query: 1682 caaccttgattgaga 1696
|||||||||||||||
Sbjct: 3085 caaccttgattgaga 3099


>AE006081 Pasteurella multocida subsp. multocida str. Pm70 section 48
of 204 of the complete genome.
Length = 11341

Score = 30.2 bits (15), Expect = 3.3
Identities = 15/15 (100%)
Strand = Plus / Minus


Query: 1588 aactatgatcgcaaa 1602
|||||||||||||||
Sbjct: 5433 aactatgatcgcaaa 5419


>AE006058 Pasteurella multocida subsp. multocida str. Pm70 section 25
of 204 of the complete genome.
Length = 10592

Score = 30.2 bits (15), Expect = 3.3
Identities = 15/15 (100%)
Strand = Plus / Minus


Query: 147 tggtggcggaaaatc 161
|||||||||||||||
Sbjct: 8603 tggtggcggaaaatc 8589


>AE006038 Pasteurella multocida subsp. multocida str. Pm70 section 5 of
204 of the complete genome.
Length = 12631

Score = 30.2 bits (15), Expect = 3.3
Identities = 15/15 (100%)
Strand = Plus / Minus


Query: 1770 ctttggcaaaccgtt 1784
|||||||||||||||
Sbjct: 12439 ctttggcaaaccgtt 12425


Database: pm
Posted date: Nov 4, 2009 5:54 PM
Number of letters in database: 2,269,587
Number of sequences in database: 204

Lambda K H
1.37 0.711 1.31

Gapped
Lambda K H
1.37 0.711 1.31


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Sequences: 204
Number of Hits to DB: 37,135
Number of extensions: 14
Number of successful extensions: 14
Number of sequences better than 10.0: 13
Number of HSP's gapped: 14
Number of HSP's successfully gapped: 14
Length of query: 1830
Length of database: 2,269,587
Length adjustment: 16
Effective length of query: 1814
Effective length of database: 2,266,323
Effective search space: 4111109922
Effective search space used: 4111109922
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
X3: 50 (99.1 bits)
S1: 15 (30.2 bits)
S2: 15 (30.2 bits)