Документ взят из кэша поисковой машины. Адрес оригинального документа : http://kodomo.cmm.msu.ru/~alexus/projects/moeb_homologs2.txt Дата изменения: Thu Nov 5 05:08:25 2009 Дата индексирования: Tue Oct 2 14:39:36 2012 Кодировка:

BLASTN 2.2.21 [Jun-14-2009]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.

Query= U00096 U00096.2 Escherichia coli str. K-12 substr. MG1655,
complete genome.
(750 letters)

Database: pm
204 sequences; 2,269,587 total letters

Searching..................................................done



Score E
Sequences producing significant alignments: (bits) Value

AE006126 Pasteurella multocida subsp. multocida str. Pm70 sectio... 34 0.085
AE006084 Pasteurella multocida subsp. multocida str. Pm70 sectio... 32 0.34
AE006155 Pasteurella multocida subsp. multocida str. Pm70 sectio... 30 1.3
AE006147 Pasteurella multocida subsp. multocida str. Pm70 sectio... 30 1.3
AE006118 Pasteurella multocida subsp. multocida str. Pm70 sectio... 30 1.3
AE006081 Pasteurella multocida subsp. multocida str. Pm70 sectio... 30 1.3
AE006068 Pasteurella multocida subsp. multocida str. Pm70 sectio... 30 1.3
AE006230 Pasteurella multocida subsp. multocida str. Pm70 sectio... 28 5.2
AE006218 Pasteurella multocida subsp. multocida str. Pm70 sectio... 28 5.2
AE006207 Pasteurella multocida subsp. multocida str. Pm70 sectio... 28 5.2
AE006198 Pasteurella multocida subsp. multocida str. Pm70 sectio... 28 5.2
AE006189 Pasteurella multocida subsp. multocida str. Pm70 sectio... 28 5.2
AE006164 Pasteurella multocida subsp. multocida str. Pm70 sectio... 28 5.2
AE006154 Pasteurella multocida subsp. multocida str. Pm70 sectio... 28 5.2
AE006150 Pasteurella multocida subsp. multocida str. Pm70 sectio... 28 5.2
AE006132 Pasteurella multocida subsp. multocida str. Pm70 sectio... 28 5.2
AE006109 Pasteurella multocida subsp. multocida str. Pm70 sectio... 28 5.2
AE006099 Pasteurella multocida subsp. multocida str. Pm70 sectio... 28 5.2
AE006089 Pasteurella multocida subsp. multocida str. Pm70 sectio... 28 5.2
AE006054 Pasteurella multocida subsp. multocida str. Pm70 sectio... 28 5.2
AE006048 Pasteurella multocida subsp. multocida str. Pm70 sectio... 28 5.2

>AE006126 Pasteurella multocida subsp. multocida str. Pm70 section 93
of 204 of the complete genome.
Length = 12635

Score = 34.2 bits (17), Expect = 0.085
Identities = 20/21 (95%)
Strand = Plus / Minus


Query: 620 aagcgatcaaaatgctggcag 640
|||||||||||| ||||||||
Sbjct: 9210 aagcgatcaaaaagctggcag 9190


>AE006084 Pasteurella multocida subsp. multocida str. Pm70 section 51
of 204 of the complete genome.
Length = 10499

Score = 32.2 bits (16), Expect = 0.34
Identities = 16/16 (100%)
Strand = Plus / Plus


Query: 77 aggaggcgctgaaaga 92
||||||||||||||||
Sbjct: 3479 aggaggcgctgaaaga 3494


>AE006155 Pasteurella multocida subsp. multocida str. Pm70 section
122 of 204 of the complete genome.
Length = 10827

Score = 30.2 bits (15), Expect = 1.3
Identities = 15/15 (100%)
Strand = Plus / Plus


Query: 78 ggaggcgctgaaaga 92
|||||||||||||||
Sbjct: 145 ggaggcgctgaaaga 159


>AE006147 Pasteurella multocida subsp. multocida str. Pm70 section 114
of 204 of the complete genome.
Length = 14766

Score = 30.2 bits (15), Expect = 1.3
Identities = 15/15 (100%)
Strand = Plus / Plus


Query: 593 gcgtaattggttcgt 607
|||||||||||||||
Sbjct: 1523 gcgtaattggttcgt 1537


>AE006118 Pasteurella multocida subsp. multocida str. Pm70 section 85
of 204 of the complete genome.
Length = 11828

Score = 30.2 bits (15), Expect = 1.3
Identities = 18/19 (94%)
Strand = Plus / Minus


Query: 537 gtttggtgaaaatgcatta 555
||||| |||||||||||||
Sbjct: 5524 gtttgctgaaaatgcatta 5506


>AE006081 Pasteurella multocida subsp. multocida str. Pm70 section 48
of 204 of the complete genome.
Length = 11341

Score = 30.2 bits (15), Expect = 1.3
Identities = 15/15 (100%)
Strand = Plus / Plus


Query: 534 tttgtttggtgaaaa 548
|||||||||||||||
Sbjct: 3577 tttgtttggtgaaaa 3591


>AE006068 Pasteurella multocida subsp. multocida str. Pm70 section 35
of 204 of the complete genome.
Length = 11223

Score = 30.2 bits (15), Expect = 1.3
Identities = 15/15 (100%)
Strand = Plus / Minus


Query: 562 gtggaagcaggcgta 576
|||||||||||||||
Sbjct: 9023 gtggaagcaggcgta 9009


>AE006230 Pasteurella multocida subsp. multocida str. Pm70 section 197
of 204 of the complete genome.
Length = 10325

Score = 28.2 bits (14), Expect = 5.2
Identities = 14/14 (100%)
Strand = Plus / Minus


Query: 61 tttgattttgacgg 74
||||||||||||||
Sbjct: 9817 tttgattttgacgg 9804


>AE006218 Pasteurella multocida subsp. multocida str. Pm70 section 185
of 204 of the complete genome.
Length = 10302

Score = 28.2 bits (14), Expect = 5.2
Identities = 14/14 (100%)
Strand = Plus / Minus


Query: 61 tttgattttgacgg 74
||||||||||||||
Sbjct: 2367 tttgattttgacgg 2354


>AE006207 Pasteurella multocida subsp. multocida str. Pm70 section 174
of 204 of the complete genome.
Length = 10499

Score = 28.2 bits (14), Expect = 5.2
Identities = 14/14 (100%)
Strand = Plus / Plus


Query: 300 tatcgcgattacgc 313
||||||||||||||
Sbjct: 9293 tatcgcgattacgc 9306


>AE006198 Pasteurella multocida subsp. multocida str. Pm70 section 165
of 204 of the complete genome.
Length = 12956

Score = 28.2 bits (14), Expect = 5.2
Identities = 14/14 (100%)
Strand = Plus / Plus


Query: 302 tcgcgattacgcca 315
||||||||||||||
Sbjct: 8652 tcgcgattacgcca 8665



Score = 28.2 bits (14), Expect = 5.2
Identities = 14/14 (100%)
Strand = Plus / Plus


Query: 543 tgaaaatgcattaa 556
||||||||||||||
Sbjct: 9428 tgaaaatgcattaa 9441


>AE006189 Pasteurella multocida subsp. multocida str. Pm70 section 156
of 204 of the complete genome.
Length = 10307

Score = 28.2 bits (14), Expect = 5.2
Identities = 14/14 (100%)
Strand = Plus / Minus


Query: 587 tgatcggcgtaatt 600
||||||||||||||
Sbjct: 7295 tgatcggcgtaatt 7282


>AE006164 Pasteurella multocida subsp. multocida str. Pm70 section 131
of 204 of the complete genome.
Length = 13857

Score = 28.2 bits (14), Expect = 5.2
Identities = 14/14 (100%)
Strand = Plus / Minus


Query: 663 gaaaatcgtcatgt 676
||||||||||||||
Sbjct: 12043 gaaaatcgtcatgt 12030


>AE006154 Pasteurella multocida subsp. multocida str. Pm70 section 121
of 204 of the complete genome.
Length = 11090

Score = 28.2 bits (14), Expect = 5.2
Identities = 14/14 (100%)
Strand = Plus / Minus


Query: 586 ttgatcggcgtaat 599
||||||||||||||
Sbjct: 4344 ttgatcggcgtaat 4331


>AE006150 Pasteurella multocida subsp. multocida str. Pm70 section 117
of 204 of the complete genome.
Length = 10723

Score = 28.2 bits (14), Expect = 5.2
Identities = 14/14 (100%)
Strand = Plus / Minus


Query: 311 cgccagtcaatgca 324
||||||||||||||
Sbjct: 6192 cgccagtcaatgca 6179


>AE006132 Pasteurella multocida subsp. multocida str. Pm70 section 99 of
204 of the complete genome.
Length = 11793

Score = 28.2 bits (14), Expect = 5.2
Identities = 14/14 (100%)
Strand = Plus / Minus


Query: 60 ctttgattttgacg 73
||||||||||||||
Sbjct: 10035 ctttgattttgacg 10022


>AE006109 Pasteurella multocida subsp. multocida str. Pm70 section 76
of 204 of the complete genome.
Length = 13603

Score = 28.2 bits (14), Expect = 5.2
Identities = 14/14 (100%)
Strand = Plus / Minus


Query: 538 tttggtgaaaatgc 551
||||||||||||||
Sbjct: 9507 tttggtgaaaatgc 9494


>AE006099 Pasteurella multocida subsp. multocida str. Pm70 section 66
of 204 of the complete genome.
Length = 11156

Score = 28.2 bits (14), Expect = 5.2
Identities = 14/14 (100%)
Strand = Plus / Minus


Query: 533 gtttgtttggtgaa 546
||||||||||||||
Sbjct: 2770 gtttgtttggtgaa 2757


>AE006089 Pasteurella multocida subsp. multocida str. Pm70 section 56 of
204 of the complete genome.
Length = 12519

Score = 28.2 bits (14), Expect = 5.2
Identities = 14/14 (100%)
Strand = Plus / Plus


Query: 351 attgattgctgaac 364
||||||||||||||
Sbjct: 10197 attgattgctgaac 10210


>AE006054 Pasteurella multocida subsp. multocida str. Pm70 section 21
of 204 of the complete genome.
Length = 11152

Score = 28.2 bits (14), Expect = 5.2
Identities = 14/14 (100%)
Strand = Plus / Plus


Query: 474 aggtcaaatcaccg 487
||||||||||||||
Sbjct: 7931 aggtcaaatcaccg 7944


>AE006048 Pasteurella multocida subsp. multocida str. Pm70 section 15
of 204 of the complete genome.
Length = 12232

Score = 28.2 bits (14), Expect = 5.2
Identities = 14/14 (100%)
Strand = Plus / Minus


Query: 712 ctgatgcgtaatcc 725
||||||||||||||
Sbjct: 3688 ctgatgcgtaatcc 3675


Database: pm
Posted date: Nov 5, 2009 1:39 AM
Number of letters in database: 2,269,587
Number of sequences in database: 204

Lambda K H
1.37 0.711 1.31

Gapped
Lambda K H
1.37 0.711 1.31


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Sequences: 204
Number of Hits to DB: 13,771
Number of extensions: 22
Number of successful extensions: 22
Number of sequences better than 10.0: 21
Number of HSP's gapped: 22
Number of HSP's successfully gapped: 22
Length of query: 750
Length of database: 2,269,587
Length adjustment: 15
Effective length of query: 735
Effective length of database: 2,266,527
Effective search space: 1665897345
Effective search space used: 1665897345
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
X3: 50 (99.1 bits)
S1: 14 (28.2 bits)
S2: 14 (28.2 bits)