Документ взят из кэша поисковой машины. Адрес оригинального документа : http://kodomo.cmm.msu.ru/~megabotan/term6/gibbs_r_g.txt Дата изменения: Wed May 30 16:50:03 2012 Дата индексирования: Tue Oct 2 12:31:49 2012 Кодировка: Поисковые слова: m 8

=============================================================
/tmp/gibbs9242/Gibbs9242 /tmp/gibbs9242/data.txt 16 20 -n -r -W 0.8 -w 0.1 -p 200 -j 5 -i 2000 -S 40 -C 0.5 -P /tmp/gibbs9242/prior.txt -R 1,1,8 -U /tmp/gibbs9242/spacing.txt -M 1,24 -B /tmp/gibbs9242/data.txt_info-det -y -nopt -o /tmp/gibbs9242/outfile.txt


Gibbs 3.10.001 Sep 8 2009
Data file: /tmp/gibbs9242/data.txt
Output file: /tmp/gibbs9242/outfile.txt
Priors file: /tmp/gibbs9242/prior.txt
Background Composition Model file: /tmp/gibbs9242/data.txt_info-det
Spacing Model file: /tmp/gibbs9242/spacing.txt
Current directory: /tmp/gibbs9242
The following options are set:
Concentrated Region False Sequence type False
Collapsed Alphabet False Pseudocount weight True
Use Expectation/Maximization False Don't Xnu sequence False
Help flag False Near optimal cutoff True
Number of iterations True Don't fragment False
Don't use map maximization False Repeat regions False
Output file True Informed priors file True
Plateau periods True palindromic sequence True
Don't Reverse complement True Number of seeds True
Seed Value False Pseudosite weight True
Suboptimal sampler output False Overlap False
Allow width to vary False Wilcoxon signed rank False
Sample along length False Output Scan File False
Output prior file False Modular Sampler False
Ignore Spacing Model False Sample Background False
Bkgnd Comp Model True Init from prior False
Homologous Seq pairs False Parallel Tempering False
Group Sampler False No progress info False
Fragment from middle False Verify Mode False
Alternate sample on k False No freq. soln. True
Calc. def. pseudo wt. False Motif/Recur smpl False
Phylogenetic Sampling False Supress Near Opt. True
Nearopt display cutoff False Sample model False
Hierarchical Model False Centroid model False
Print Bayesian Counts False Align Centroid False
Calculate Credibility Limits False Frequency Bkgnd. False

site_samp = 0
nMotifLen = 16
nAlphaLen = 4
nNumMotifs = 20
dPseudoCntWt = 0.1
dPseudoSiteWt = 0.8
nMaxIterations = 2000
lSeedVal = 1338379094
nPlateauPeriods = 200
nSeeds = 40
nNumMotifTypes = 1
dCutoff = 0.5
dNearOptDispCutoff = 0.5
RevComplement = 0
glOverlapParam = 0
Rcutoff factor = 0
Post Plateau Samples = 0
Frag/Shft Per. = 5
Frag width = 24


Sequences to be Searched:
_________________________
#1 pheA
#2 aroH2
#3 tyrB
#4 aroKB1
#5 aroF+tyrA
#6 aroA
#7 aroL
#8 aroC
#9 aroG
#10 aroD+ydiB
Processed Sequence Length: 2000 Total sequence length: 2000










======================================================================
======================== MAP MAXIMIZATION RESULTS ====================
======================================================================

-------------------------------------------------------------------------
MOTIF a





Motif model (residue frequency x 100)
____________________________________________
Pos. # a t c g Info
_____________________________
1 | 55 33 . 11 0.3

3 | 11 88 . . 0.8
4 | . 11 11 77 0.8
5 | . 66 . 33 0.6
6 | 100 . . . 1.1
7 | 77 22 . . 0.6
8 | 44 55 . . 0.4

11 | 33 55 11 . 0.3
12 | 55 22 11 11 0.2

15 | . 100 . . 1.0
16 | 11 77 . 11 0.5
17 | 11 88 . . 0.8
18 | 66 . 33 . 0.6
19 | . . 100 . 1.4
20 | 44 44 . 11 0.2

22 | 44 44 11 . 0.2

nonsite 28 30 20 20
site 34 44 11 9

Motif probability model
____________________________________________
Pos. # a t c g
____________________________________________
1 | 0.506 0.327 0.038 0.129

3 | 0.143 0.782 0.038 0.038
4 | 0.052 0.146 0.128 0.674
5 | 0.052 0.600 0.038 0.311
6 | 0.870 0.055 0.038 0.038
7 | 0.688 0.236 0.038 0.038
8 | 0.415 0.509 0.038 0.038

11 | 0.325 0.509 0.128 0.038
12 | 0.506 0.236 0.128 0.129

15 | 0.052 0.873 0.038 0.038
16 | 0.143 0.691 0.038 0.129
17 | 0.143 0.782 0.038 0.038
18 | 0.597 0.055 0.310 0.038
19 | 0.052 0.055 0.856 0.038
20 | 0.415 0.418 0.038 0.129

22 | 0.415 0.418 0.128 0.038



Background probability model
0.280 0.289 0.214 0.217



16 columns
Num Motifs: 9
5, 1 34 aaggg AGTGTAAATTTATCTATACAGA ggtaa 55 0.91 F aroF+tyrA
5, 2 86 ttgcc TGTGTAAATAAAAATGTACGAA atatg 107 0.69 F aroF+tyrA
5, 3 109 cgaaa TATGGATTGAAAACTTTACTTT atgtg 130 0.74 F aroF+tyrA
6, 1 127 tagcc ACAGGAATAATGTATTACCTGT ggtcg 148 0.33 F aroA
7, 1 18 ggcta AATGTAATTTATTATTTACACT tcatt 39 0.88 F aroL
7, 2 94 cttta AGTGGAATTTTTTCTTTACAAT cgaaa 115 0.88 F aroL
8, 1 42 atctg TCTCTATTTCTAATTTTCCTAC agttt 63 0.00 F aroC
8, 2 93 cgatc GTTTTAAACGTATTTTTCCTCA ctcac 114 0.60 F aroC
9, 1 111 ttcat AGTGTAAAACCCCGTTTACACA ttctg 132 0.90 F aroG
* ****** ** ****** *


Column 1 : Sequence Number, Site Number
Column 2 : Left End Location
Column 4 : Motif Element
Column 6 : Right End Location
Column 7 : Probability of Element
Column 8 : Forward Motif (F) or Reverse Complement (R)
Column 9 : Sequence Description from Fast A input

Log Motif portion of MAP for motif a = -132.87875
Log Fragmentation portion of MAP for motif a = -4.78749


Log Background portion of Map = -2561.69422
Log Alignment portion of Map = -60.17486
Log Site/seq portion of Map = 0.00000
Log Null Map = -2756.73189
Non Palindromic Map = -14.49424
Log Map = -2.80343


log MAP = sum of motif and fragmentation parts of MAP + background + alignment + sites/seq - Null

Frequency Map = -3.675989
Nearopt Map = -3.214298
Maximal Map = -2.803425
Elapsed time: 15.080000 secs